ID: 1091277161

View in Genome Browser
Species Human (GRCh38)
Location 11:134360389-134360411
Sequence ACTGCTGGTCCTCCCCATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091277161_1091277164 -1 Left 1091277161 11:134360389-134360411 CCGGCATGGGGAGGACCAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 170
Right 1091277164 11:134360411-134360433 TGATCCCCACGGCTTCCACGCGG 0: 1
1: 0
2: 0
3: 4
4: 76
1091277161_1091277170 18 Left 1091277161 11:134360389-134360411 CCGGCATGGGGAGGACCAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 170
Right 1091277170 11:134360430-134360452 GCGGTGGCGCCGTCTCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 83
1091277161_1091277165 2 Left 1091277161 11:134360389-134360411 CCGGCATGGGGAGGACCAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 170
Right 1091277165 11:134360414-134360436 TCCCCACGGCTTCCACGCGGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1091277161_1091277172 30 Left 1091277161 11:134360389-134360411 CCGGCATGGGGAGGACCAGCAGT 0: 1
1: 0
2: 1
3: 7
4: 170
Right 1091277172 11:134360442-134360464 TCTCCCCACGGCTGCTTCCAAGG 0: 1
1: 0
2: 3
3: 10
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091277161 Original CRISPR ACTGCTGGTCCTCCCCATGC CGG (reversed) Intronic
900364852 1:2307009-2307031 CCTGCTGGTCCTCTGCTTGCTGG + Exonic
900601125 1:3503080-3503102 ACCGGTGCTCCTCCCCAGGCAGG - Intronic
902334015 1:15744558-15744580 GCTGCTGGTCATCTACATGCAGG + Exonic
902653550 1:17852442-17852464 TCTGTTGCTCCTGCCCATGCTGG + Intergenic
904891312 1:33781821-33781843 ACAGCTGGTCGCCCCCATGGAGG + Intronic
905655665 1:39684586-39684608 GCTGTTGGTCTTCCCCATGGCGG + Exonic
906982327 1:50644792-50644814 ACTGCTGCTTCTGCCCATGAAGG - Intronic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
910426056 1:87120864-87120886 TCTGCTGCTCCTGTCCATGCTGG + Intronic
910857384 1:91709099-91709121 AGTGTTGGTCCTCACCAAGCTGG + Intronic
912971019 1:114282981-114283003 AGTGCTGGAGCTCCCCCTGCAGG + Intergenic
914950299 1:152108167-152108189 GCTGCTGTTCCTCCCCTTCCTGG + Exonic
915095067 1:153456800-153456822 ACTGGTGGGTCTCTCCATGCAGG - Intergenic
924638623 1:245812337-245812359 TGTGCTGGCCCTCCTCATGCAGG + Intronic
1062862436 10:821414-821436 CATTCTGGACCTCCCCATGCAGG + Intronic
1064268622 10:13845925-13845947 CCTGCTGGTCCTCTGCATTCAGG + Intronic
1065170167 10:23019025-23019047 ACTGCTGGTTCTCCCAATGTGGG + Intronic
1066442882 10:35455442-35455464 CCTGCTGAGCCTCCCTATGCTGG - Intronic
1067177162 10:43958207-43958229 GCTGCTGCTCCTCTCCATTCAGG - Intergenic
1067839772 10:49666292-49666314 CCTGCCTGTCCTGCCCATGCTGG - Intergenic
1069958970 10:72068502-72068524 AGAGCTGGTCCTAGCCATGCAGG + Intronic
1070285325 10:75079355-75079377 AGTGCTGGTGGCCCCCATGCTGG + Intergenic
1075024921 10:118977407-118977429 ACAGCAGGTACTCCTCATGCAGG + Intergenic
1075788844 10:125068964-125068986 ACTGCTGATCCTCCCATCGCAGG + Intronic
1076491274 10:130863177-130863199 CCTCATGGTCCTCCACATGCAGG - Intergenic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1079837402 11:25351130-25351152 ACTGCTAATCCTCCCCGAGCAGG - Intergenic
1080928539 11:36783762-36783784 GCTCCTGTTCCTTCCCATGCCGG - Intergenic
1081218940 11:40436772-40436794 AGTGCTGTTCTTCACCATGCTGG - Intronic
1083078825 11:60069588-60069610 ACTGCTGATTCTCACCTTGCTGG + Exonic
1083492984 11:63026855-63026877 ACTGCTGGGCTTCCCCCTCCAGG + Intergenic
1084439877 11:69166767-69166789 ACTGCTGGGGATCCCCCTGCAGG - Intergenic
1090765194 11:129870261-129870283 AGTGCTGCTTCTCCCCATTCAGG - Exonic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1092570377 12:9715059-9715081 GCTGCAGCTCCTCCTCATGCAGG + Intergenic
1095702087 12:45201025-45201047 ACTGCCAGGGCTCCCCATGCTGG + Intergenic
1099652225 12:85442910-85442932 AATGCTGGTCCGTCTCATGCAGG - Intergenic
1102510230 12:113410206-113410228 ACAGCTGGTGCTCCCATTGCTGG + Intronic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103270344 12:119668240-119668262 ACTGCTGGTATTGCCCATGATGG - Exonic
1103932312 12:124457308-124457330 CCTGCAGGCCCTCCCCACGCTGG + Intronic
1104032897 12:125078174-125078196 GCTGCTGGTCCTTCCCACGATGG - Intronic
1104648514 12:130514188-130514210 ACTGCTATTCCTGTCCATGCCGG + Intronic
1106368627 13:29108785-29108807 CCTGCAGGTCCTCTCCAGGCTGG + Intronic
1106439177 13:29750342-29750364 ACTGATTGTCCTTCCCATGTGGG - Intergenic
1110396845 13:75040047-75040069 ACTGTTGGTCTTCCCCATACTGG + Intergenic
1113448196 13:110386845-110386867 GCTGCTGGCCATCCCCATGAAGG + Intronic
1119948432 14:78719358-78719380 GCTGCTGCTCCTCTCCATTCGGG + Intronic
1120909075 14:89649192-89649214 ACTGTGGTTTCTCCCCATGCCGG - Intergenic
1121322940 14:93003133-93003155 TCTGTTAGTCCTCCCCCTGCAGG - Intronic
1121506782 14:94483726-94483748 ACTGAGTGTCCTCTCCATGCGGG - Intergenic
1122367472 14:101202705-101202727 CCGGCTGTGCCTCCCCATGCTGG - Intergenic
1122774266 14:104110293-104110315 GCTGCTAGTCCTCCTCCTGCTGG - Intronic
1122774610 14:104111714-104111736 ATGCCTGGCCCTCCCCATGCAGG + Intronic
1126253979 15:46603209-46603231 ACTGCTCTTCCTCCCCAGTCAGG - Intergenic
1129231047 15:74197393-74197415 GCTGCTGCTCCTGGCCATGCTGG - Exonic
1135309696 16:21395842-21395864 ACTGCTGGAACTCCCCACCCTGG - Intergenic
1135322781 16:21508065-21508087 AATGCTGAGCCTGCCCATGCCGG + Intergenic
1136549681 16:30976381-30976403 TCGCCTGGGCCTCCCCATGCTGG + Intronic
1137758753 16:50923705-50923727 ACTGCTGGTCTTTCCCACGAAGG + Intergenic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1147969325 17:44211128-44211150 GCTGCTGCTCCTCCTCAGGCAGG + Exonic
1149992062 17:61388822-61388844 CCTTCTGCTCCTCCCCCTGCAGG - Intronic
1151556904 17:74851307-74851329 TCTCCTGGTCCTGCCCCTGCAGG - Intronic
1152008668 17:77697561-77697583 ACTGCAGTTGCTCCCCATGACGG - Intergenic
1152067783 17:78121113-78121135 GCTGCTGGTCCTGCCCCTGGTGG - Exonic
1152126584 17:78450846-78450868 ACTCCTGCACCTCCCCTTGCAGG - Exonic
1155311985 18:24532930-24532952 GCTGCTTGTCCTCCCCACCCTGG - Intergenic
1156969412 18:43137193-43137215 ACTCTTGGTCCTCCCCAATCTGG + Intergenic
1158545594 18:58393572-58393594 ACTGCCAGTCCTCTCCATCCGGG - Intronic
1160021213 18:75183430-75183452 GCTGCTGGGCTTCCCCATGAAGG - Intergenic
1160184017 18:76660702-76660724 CCTGCTCCTCCTCCCCATTCTGG - Intergenic
1163492084 19:17623102-17623124 AATGCAGGTCCTCACCATGAGGG - Intronic
1165340500 19:35208420-35208442 ACTGCTGGTCCCCCAAAGGCGGG - Intergenic
1166998122 19:46729482-46729504 CCCTCTGGTCCCCCCCATGCAGG - Intronic
1167231932 19:48290513-48290535 ACTCATGGCCCTCCCCATCCTGG + Intergenic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
925294965 2:2770167-2770189 CCAGCTGCACCTCCCCATGCCGG + Intergenic
925368023 2:3324426-3324448 ACTGCTGCTCCTCAGGATGCAGG + Intronic
926118157 2:10226135-10226157 ACTTCTGGACCTTCACATGCTGG - Intergenic
927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG + Intronic
928195901 2:29216237-29216259 GCTGCAGGTGCTCCCCATGGTGG + Intronic
930070343 2:47361121-47361143 ACTTCTGGCCCTCCCTATGATGG + Intronic
931654025 2:64493654-64493676 ACTGCTGGTCAGACCCCTGCAGG + Intergenic
934907892 2:98221723-98221745 ACTGCTGCTCCTGCCCACTCAGG - Intronic
935517273 2:104056287-104056309 TCTGCTGGTTCTCTCCATGCTGG - Intergenic
937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG + Intronic
945023237 2:205595051-205595073 ACTGCCTTTCCTCCCCTTGCAGG - Intronic
946159589 2:217828090-217828112 ACTGCTGGTCCTGGCAAGGCAGG - Intronic
946192190 2:218013499-218013521 ACTGTTGGACCTCCACATGGGGG - Intergenic
947527246 2:230886217-230886239 TCTGCTGTGCCTCCCCATGAGGG - Intergenic
947843854 2:233228001-233228023 ACTCCAGGTCCTTCTCATGCTGG + Intronic
948307250 2:236957426-236957448 ACTGCTGACCCTGCACATGCAGG - Intergenic
1169207874 20:3750115-3750137 ACTGCTGGCCCACACCGTGCAGG + Exonic
1171397103 20:24842470-24842492 TCTGCTCCTCCTTCCCATGCAGG + Intergenic
1175036251 20:56004108-56004130 GCTGCTGGTCCTCACGCTGCCGG - Exonic
1175780188 20:61677159-61677181 ACTGCTGGGACTCCCCAGGGTGG + Intronic
1179905104 21:44418636-44418658 ATTGCTGGGCCTCCCCAGGTGGG - Intronic
1182476852 22:30581155-30581177 ACTGCTGCCCCTCCCCACCCTGG - Intronic
1182584084 22:31333597-31333619 GGTGCTGGTCCAACCCATGCTGG - Intronic
1183196589 22:36357907-36357929 ACTGATGTGCCTCCCCAGGCAGG + Intronic
1183424281 22:37730499-37730521 CCTCCTGGTCCTCCCCATTAGGG + Intronic
1184152742 22:42648217-42648239 ACTCCAGGTCCTCCCCAAGGAGG + Intronic
1185017099 22:48351220-48351242 CCTCCTGGTCCACGCCATGCTGG + Intergenic
950744242 3:15074194-15074216 ACTACTGGTCCTCCTGCTGCAGG - Exonic
950955449 3:17048017-17048039 TCTGCTGGTTTTCCCCATGCAGG - Intronic
953850855 3:46464635-46464657 GCTCCTGTTCCTCCCCATGTGGG + Intronic
953885798 3:46713737-46713759 ACTCCTGGTCGTCCCAATTCAGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954943015 3:54392594-54392616 CCTCCTGGTCCTCACCAAGCTGG + Intronic
955091266 3:55753085-55753107 ACTGCTGGAACTCCCCAAGTGGG + Intronic
961642277 3:128371953-128371975 ACTCCTGGTCCGCACCAGGCTGG - Intronic
961657608 3:128452095-128452117 ACCGCTGTGCCTCCCCATGCCGG + Intergenic
962084199 3:132173525-132173547 TCTGCTGCTCCTCACCAGGCAGG + Intronic
962901396 3:139765012-139765034 AGTGCTGGCCCTGCCCATGGAGG - Intergenic
968760908 4:2442460-2442482 ACTGCTGTGCCTCCCCAGGGTGG - Intronic
969504154 4:7573830-7573852 ACTTCAGGGGCTCCCCATGCAGG + Intronic
971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG + Intergenic
971611332 4:28730621-28730643 CCTGGTGGTCCTGCCCATGATGG - Intergenic
982280497 4:153679656-153679678 CCTGCTGATCCTGCCCATGGGGG + Intergenic
985026225 4:185741976-185741998 GCTGCTGGTCCTGCCAAGGCTGG + Intronic
985588550 5:753188-753210 TCAGCTGGGCCTCCCCATGGGGG + Intronic
985603217 5:845627-845649 TCAGCTGGGCCTCCCCATGGGGG + Intronic
989329942 5:40245413-40245435 ACTGATTGTCCCCACCATGCAGG + Intergenic
995186872 5:109281096-109281118 TCTGCTGGCTCTCCACATGCAGG - Intergenic
997065790 5:130556958-130556980 ACCGCTGCTCTTCACCATGCAGG + Intergenic
1002804971 6:564612-564634 ACTGCTTGGCTTCCCCATCCCGG + Exonic
1006285926 6:33094088-33094110 AGGACTGGTTCTCCCCATGCTGG - Intergenic
1010062299 6:71636718-71636740 AATGCTGCCCCTCTCCATGCAGG - Intergenic
1011596654 6:89023148-89023170 GCTGCTGATCCTCCAAATGCAGG - Intergenic
1012253635 6:97008045-97008067 CCTGCTGCACCTCCTCATGCAGG + Intronic
1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG + Intronic
1017776489 6:157684890-157684912 ACTGCTTATCCTCCCCATCGTGG - Intergenic
1017906486 6:158760426-158760448 CAAGCTGTTCCTCCCCATGCTGG + Intronic
1018062975 6:160104811-160104833 TGTCCTGGTCATCCCCATGCAGG - Exonic
1018637536 6:165876874-165876896 ACAGCTGCTCCTCCCTTTGCTGG - Intronic
1019325224 7:434861-434883 ACGGCTGCTCTTCCCCATCCGGG - Intergenic
1019542557 7:1558146-1558168 GCTGCTGGTCCTCCCTCTGCAGG + Intronic
1019577704 7:1745502-1745524 ACTGGTGGCCCTGCCCACGCTGG + Exonic
1021202432 7:17741632-17741654 CCTGCTGCTCCTCGCCAGGCAGG + Intergenic
1024264087 7:47593507-47593529 ACTGCTGTGCCTCATCATGCTGG - Intergenic
1024564447 7:50669838-50669860 ACTGCTGGTCTTCCTCCTGAAGG + Exonic
1026984812 7:74547997-74548019 ACTGCTGGTCCTTCCCATTCTGG - Intronic
1029409180 7:100397916-100397938 AGTGCTGGGCCTCCCCAGGGTGG + Intronic
1033167628 7:139054445-139054467 ATTGCTTAGCCTCCCCATGCTGG - Intronic
1034162218 7:149002154-149002176 ACTGCTGCTCCTCCCCAGAGAGG + Intergenic
1034226563 7:149489508-149489530 ACTGCAGGCCCTCCCCACCCAGG - Intronic
1035566293 8:643490-643512 ACTGATGGTCACCCCCGTGCAGG + Intronic
1039804297 8:40985292-40985314 CCTGCTGATCCTCCTCAAGCGGG + Intergenic
1039809916 8:41037528-41037550 ACTTGTGGTCCTAGCCATGCAGG + Intergenic
1040850602 8:51898286-51898308 CCCGTGGGTCCTCCCCATGCCGG + Intronic
1041601282 8:59719658-59719680 CCTGCTGGTCCTTCCCACTCTGG + Intergenic
1042104316 8:65308483-65308505 TCTGCTGGGCCTCAGCATGCTGG - Intergenic
1044212316 8:89564011-89564033 ACTGCAGGCCTTCCCCTTGCAGG - Intergenic
1044945710 8:97386968-97386990 ACTGCAGGTCCCACCCATGGTGG + Intergenic
1045019664 8:98031008-98031030 ATTGCTGGCCCTGCCCATGAAGG - Intronic
1045277378 8:100720961-100720983 ACTGCACTTCCTCCCCAGGCTGG + Intronic
1046366984 8:113246974-113246996 ACTTCTGGTCCTCCACCAGCAGG - Intronic
1047224674 8:122946219-122946241 GGTGCTGGTCCTCACCTTGCTGG + Intronic
1047233357 8:123016742-123016764 ACTGCTGTCCCTTCCCAGGCAGG - Intronic
1048770499 8:137889853-137889875 ACTGCTGGTTCTCCCAGGGCAGG + Intergenic
1049656860 8:143802834-143802856 ACTGCTGGTCCGTCCCTTCCTGG - Intronic
1049928021 9:428667-428689 ACTGCTTTTCCTCTCCATGGTGG - Intronic
1051682640 9:19623301-19623323 CCTTCTGGTCCTCCCCATTAGGG + Intronic
1052206264 9:25844882-25844904 ACTGCTGGTTCTCCACAGCCTGG - Intergenic
1052206291 9:25845080-25845102 ACTGCTGGTTCTCCACAGCCTGG - Intergenic
1054954206 9:70889281-70889303 ACTTCTGGTCTTCCCCTTGGTGG - Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1057498507 9:95578607-95578629 CCTGCTGTTGTTCCCCATGCTGG + Intergenic
1057747620 9:97764363-97764385 ACTGCAGGGCCTCACCATGAAGG + Intergenic
1058001328 9:99869084-99869106 GATGCTGGCCATCCCCATGCTGG + Intergenic
1059399762 9:114061539-114061561 CCTGCTGGTCATTCCCATGCAGG + Exonic
1059406479 9:114101147-114101169 ATTGCTGGCCCTCCTCAGGCTGG + Intergenic
1060983830 9:127808623-127808645 ACCGCTGGTGCTCCCCCTCCAGG - Exonic
1061288113 9:129635726-129635748 GCTCCTGGTGCTCCCCATGTGGG + Exonic
1061383710 9:130276048-130276070 CTTTCTGGTCCTCCCCCTGCAGG - Intergenic
1188754809 X:33949377-33949399 ACAGGTGATCCTCCCCAGGCTGG - Intergenic
1193022014 X:76801333-76801355 ACTGCAGGTCCTCCCCACAAGGG - Intergenic
1193443927 X:81577079-81577101 TCTGCTGCTCCTTACCATGCAGG + Intergenic