ID: 1091279629

View in Genome Browser
Species Human (GRCh38)
Location 11:134374592-134374614
Sequence CTGTTTCAAGGGCTGGGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091279616_1091279629 25 Left 1091279616 11:134374544-134374566 CCCTCCACTTTTGCTGTGGCTCT 0: 1
1: 0
2: 1
3: 30
4: 288
Right 1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 404
1091279618_1091279629 21 Left 1091279618 11:134374548-134374570 CCACTTTTGCTGTGGCTCTCGTG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 404
1091279617_1091279629 24 Left 1091279617 11:134374545-134374567 CCTCCACTTTTGCTGTGGCTCTC 0: 1
1: 0
2: 2
3: 30
4: 223
Right 1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG 0: 1
1: 0
2: 5
3: 46
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091279629 Original CRISPR CTGTTTCAAGGGCTGGGAGA AGG Exonic
901219325 1:7574215-7574237 CTGAGCCAAGGGCTGGGAGCTGG + Intronic
901629333 1:10640667-10640689 CTACCCCAAGGGCTGGGAGAGGG + Intronic
902836668 1:19051864-19051886 CTGATTCTAGGGCTGGGGCAGGG - Intergenic
903046115 1:20565550-20565572 CTGCTTCAAGTGGAGGGAGAGGG - Intergenic
903069960 1:20722229-20722251 CAGTTTCTAGGGATGGGAGGGGG - Intronic
904410118 1:30320102-30320124 CTGTGCCAAGGCCTGGGAGCCGG - Intergenic
904720251 1:32502135-32502157 CTGATTCCAGGGCTGGGGCAGGG - Intronic
905368660 1:37470758-37470780 CTGATTTTAGGGCTGGGACAGGG - Intergenic
905632778 1:39527903-39527925 ATGTCTCAAGCTCTGGGAGAAGG - Intergenic
905996463 1:42385556-42385578 CTTTTACAAGGGCTGAGAGTGGG + Intronic
906811341 1:48830020-48830042 ATGTTCCAAAGTCTGGGAGAAGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
908020759 1:59896089-59896111 CTGATTCCAGGGCTGGGGAAGGG - Intronic
909625044 1:77705829-77705851 TGATTTCAAGGGCTGAGAGAAGG - Intronic
909705767 1:78581912-78581934 TTGTTTCTAGGGCTGGGACAGGG + Intergenic
910764304 1:90765572-90765594 CTGTTGGAAGGGCAGGGTGAGGG - Intergenic
911496382 1:98637087-98637109 CTGCTGCCAGGGGTGGGAGAGGG - Intergenic
914747123 1:150509078-150509100 ATGTTTCAAGGGCCTGGAGTAGG + Intronic
915199634 1:154217401-154217423 ATGTTGCCTGGGCTGGGAGAGGG - Intronic
915364260 1:155305387-155305409 CTGTTTCAGTGGGTGGGAAAGGG + Intergenic
915384303 1:155475511-155475533 CAGATTAAAGGGCTGGCAGAAGG - Intronic
915955517 1:160217234-160217256 TTGTTTCTTGGGCTGGGGGAGGG - Exonic
916384477 1:164251816-164251838 CTAATTCAAGGGCTGGGATAAGG + Intergenic
918026635 1:180755932-180755954 CTGATTCCAGGGCTGGGAGAGGG + Intronic
918153709 1:181822263-181822285 ATGGTTTAAGGGCTGGGAGAAGG + Intergenic
918340444 1:183563963-183563985 CTGTTTCAAGTGGTAGAAGATGG - Intronic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
918918583 1:190674718-190674740 CTGCTTCCAAGGCTGGGAGTTGG + Intergenic
920744760 1:208616412-208616434 CTGCTGCCAGGGGTGGGAGAGGG - Intergenic
922786200 1:228283486-228283508 CTTTTTCTGGGGCAGGGAGATGG - Exonic
922872239 1:228912140-228912162 CTGTTTCAGGGCCTTGGAAAGGG + Intergenic
923511118 1:234654680-234654702 CTGTTACTGGGGATGGGAGAGGG + Intergenic
923931452 1:238703625-238703647 CTGATTCTAGAGCTGGGACAAGG - Intergenic
1063216772 10:3932385-3932407 CTGTGGCAAGGGCTGGGGGCAGG + Intergenic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1067158498 10:43802644-43802666 CTGTGTCATGGGCTGGGGGTTGG - Intergenic
1069394742 10:67976685-67976707 CTCTGCCAGGGGCTGGGAGAGGG - Intronic
1069668326 10:70180188-70180210 CTGATTCTAGGGCTGGGGCAGGG + Intergenic
1069684179 10:70307072-70307094 CTGATTCCAGGGCTGGGAACAGG - Intronic
1070413633 10:76168431-76168453 CTGTTTCCAGAGCTGGGCAATGG + Intronic
1072715235 10:97747730-97747752 CTGATTCCAGGGCTGGGGCAGGG - Intronic
1073152405 10:101321092-101321114 CTGACTGAGGGGCTGGGAGAAGG + Intergenic
1073403720 10:103278472-103278494 TTGTTTGAAGGGCTGGGGCAGGG - Intronic
1073547758 10:104366333-104366355 CTGTTTCTCTGGCTGGGAGCAGG - Intronic
1074606837 10:114980248-114980270 CTGTCTCACTGGCTTGGAGAGGG + Intergenic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1077020990 11:417119-417141 CCCTTTCCAGGGCTGGGGGAAGG - Intronic
1077424652 11:2468944-2468966 CTGTGTCATGGGGTGGGTGAGGG + Intronic
1077842588 11:5991633-5991655 CTGTCACAAGGGCTCTGAGAAGG + Intergenic
1077892523 11:6429820-6429842 CAGCTTAAAGGGCTGGGAGCTGG - Intergenic
1077957265 11:7034395-7034417 CTGATTCTAGGGCTGGGACAGGG - Intronic
1078005119 11:7526783-7526805 TAGTGACAAGGGCTGGGAGAGGG + Intronic
1079185476 11:18232170-18232192 CTGTTGCAGGGGCTGGGTGCAGG - Intronic
1080597624 11:33788471-33788493 CTGTTGCAGGGTCGGGGAGAGGG + Intergenic
1080954578 11:37078359-37078381 ATGTTTCAGGGGCTGAGGGAGGG + Intergenic
1083593912 11:63910063-63910085 CTGACCCCAGGGCTGGGAGAGGG + Exonic
1083616954 11:64031029-64031051 TTGTTTCAAGGCCTGGGGGCAGG + Intronic
1084314377 11:68336159-68336181 CTGGTTCTAGGGCTGGGGCAAGG + Intronic
1084912157 11:72398815-72398837 CTGTTACTAGGGCTGGCAAAAGG + Intronic
1085454992 11:76660633-76660655 CAGATTCAAGAGCTGGGAAAGGG + Exonic
1085468498 11:76740395-76740417 CTGATTCCAGGCCTGGGACAAGG + Intergenic
1087813883 11:102637214-102637236 CTGATTCCAGGGCTGGGCCAGGG - Intergenic
1087938945 11:104070143-104070165 CTGATTCCAGGGCTGGGGCAAGG - Intronic
1088949051 11:114546738-114546760 CTGATTCTAGGGCTGGGGCAGGG + Intronic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089167287 11:116486878-116486900 GTTTTTCAGGGGCTGGGAGGTGG - Intergenic
1089428981 11:118405058-118405080 CTGATTCTAGGGCTGGGACAGGG - Intronic
1089703055 11:120257285-120257307 CTGTTTCTGGGGCAGGGAAAGGG - Intronic
1089712071 11:120322600-120322622 ATGTTCCAAGGGCTGGGCCAGGG + Intergenic
1089739673 11:120573802-120573824 CAGATAGAAGGGCTGGGAGAGGG - Intronic
1090454740 11:126838936-126838958 CTGTTTACAGGCCTGGGAGCAGG - Intronic
1090752520 11:129759996-129760018 CAGTCTTCAGGGCTGGGAGATGG - Intergenic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1091891568 12:4059206-4059228 CTGATGCTAGGGCTGGGACAAGG - Intergenic
1092721110 12:11441488-11441510 GGGTGTCAAGGGCTGGGGGAAGG + Intronic
1094643256 12:32296895-32296917 ATGTTTCAATTACTGGGAGAAGG - Intronic
1096620588 12:52862234-52862256 CTGACTCAGGAGCTGGGAGAGGG - Intergenic
1096763705 12:53865418-53865440 CTGTATCAAGTTCTGAGAGATGG - Intergenic
1097080028 12:56423164-56423186 AGGTGTCAAGGGCTGGGAGATGG - Intronic
1097506741 12:60482929-60482951 GGTTATCAAGGGCTGGGAGAGGG + Intergenic
1097741801 12:63252213-63252235 GAGTTTCAAGGGCAGGCAGAAGG - Intergenic
1097911480 12:64974671-64974693 CTGGTTGAGGGGCTAGGAGAGGG - Intergenic
1099300601 12:80890045-80890067 CTGTTCTAAAGGCTGGTAGATGG - Intronic
1099749267 12:86750961-86750983 TTGTTTAAAGTGCTGTGAGAGGG + Intronic
1100340268 12:93672349-93672371 CTGGTTCAGGGGCTGGGAGATGG - Intergenic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102593590 12:113975567-113975589 CTATTTCTAGGGCTGGGGCAGGG + Intergenic
1102781010 12:115564447-115564469 CTGCCTCCAGGGCTGGGAAACGG + Intergenic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1103698707 12:122836117-122836139 CGGTTTCAGGGGGTAGGAGACGG - Intronic
1103833533 12:123799966-123799988 GTGTTTCAAGGGAAGGCAGAAGG + Intronic
1104880906 12:132069586-132069608 CAGTTTCTGGGCCTGGGAGATGG - Exonic
1105213685 13:18272469-18272491 CTGCATCCAGGGCTGGGAGGGGG - Intergenic
1105639251 13:22245288-22245310 CTTTGACAAGGGCTGGGAGATGG - Intergenic
1105703361 13:22950446-22950468 CTGATTCTAGGGCTGGGGTAAGG - Intergenic
1105786124 13:23750992-23751014 CTGATTCCAGGGCTGGAACAAGG - Intronic
1107173350 13:37370244-37370266 CTGATTCTAGGTCTGGGACAAGG - Intergenic
1107650136 13:42536561-42536583 CACTATGAAGGGCTGGGAGAAGG + Intergenic
1107874440 13:44777706-44777728 ATTTTTCCAGGGATGGGAGAGGG + Intergenic
1108568812 13:51729308-51729330 CTGTTTAGGGGCCTGGGAGAAGG - Intronic
1108837563 13:54570922-54570944 CTGGTTCACGGCCTGGGAGTTGG + Intergenic
1111434475 13:88188709-88188731 CTGATTCTAGGGCAGGGATATGG + Intergenic
1111507194 13:89207681-89207703 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112567966 13:100567486-100567508 CTGATGCCAGGGCTGGGACAGGG - Intronic
1112739149 13:102454385-102454407 CTATTTCAAAGGGTGGGAGTTGG + Intergenic
1114169293 14:20255571-20255593 CTGTTTCTAGGGCTGGGACAAGG + Intergenic
1114395524 14:22355993-22356015 CTGATTCTAGGGCTGGGACAAGG + Intergenic
1114960482 14:27881847-27881869 CTGCTTCTAGGGTTGGGGGAGGG + Intergenic
1116919730 14:50560399-50560421 CTGCGTCCACGGCTGGGAGACGG + Intronic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117584370 14:57185175-57185197 CTGTTTCAAAGGCAAGAAGAAGG - Intergenic
1118359876 14:65046577-65046599 TTTTTTCATTGGCTGGGAGAAGG + Intronic
1119545968 14:75471687-75471709 CTGTTTCTAGGGCGGGGTGCAGG - Intronic
1120408799 14:84124022-84124044 CTGTGTCAAGAGCTGGGAGTGGG - Intergenic
1120828394 14:88975629-88975651 CTGTTTCCAGGGTTGGAACAGGG + Intergenic
1121450195 14:94002104-94002126 CTATTCCAAGGGCTGGGACTAGG + Intergenic
1122219244 14:100225530-100225552 TGGTTACCAGGGCTGGGAGAAGG + Intergenic
1122363327 14:101180244-101180266 CGGTCCCAAGGGCTGGGACATGG - Intergenic
1123038573 14:105481266-105481288 CTGTGCCAACGGCTGGGAGCAGG - Intergenic
1124174080 15:27405837-27405859 CTGATTCTAGGACTGGGGGAGGG + Intronic
1124243814 15:28053431-28053453 CTGGCACAGGGGCTGGGAGAGGG - Intronic
1124552274 15:30692889-30692911 CTGTTTCTGGGGCTTGGGGAAGG + Intronic
1124678965 15:31712777-31712799 CTGTTTCTGGGGCTTGGGGAAGG - Intronic
1126540793 15:49820931-49820953 CTGATTCAAGGGATGAGATAGGG - Intergenic
1128407614 15:67359065-67359087 CTGTTTAACAGGCTGTGAGAAGG + Intronic
1128807982 15:70547512-70547534 CTGGTTCTAGGACTGGGACAGGG + Intergenic
1129118185 15:73378017-73378039 CTGTGACAAGGGCTGTGACAAGG + Intergenic
1129634437 15:77300080-77300102 CTGATTCTAGGGCTGGGACAGGG - Intronic
1129654117 15:77511433-77511455 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1130045532 15:80441480-80441502 CTCTTTCCATGGCTGGGAGGGGG - Intronic
1130073053 15:80665302-80665324 CTGTTTAAGGGACTGAGAGAAGG + Intergenic
1130486445 15:84400927-84400949 CATTTTCAAGGGCTGGCAGGGGG + Intergenic
1131077000 15:89501626-89501648 CTGTTTCAGGTGCTGAGACATGG + Intergenic
1131169928 15:90170618-90170640 CTGTTTAGAGGGCTGGAAGGAGG + Intronic
1131344846 15:91636986-91637008 CAGTTTCCAGTGCTGGGATAGGG - Intergenic
1131354710 15:91734752-91734774 CTGATTCCAGGGTTGGGAGAGGG + Intergenic
1132031708 15:98444127-98444149 CTGTTTCAAGAGCTGGGAGTCGG - Intronic
1133692445 16:8229773-8229795 ATGTTTAAAGGGCTTGGAGGTGG + Intergenic
1134512880 16:14862910-14862932 CAGGAACAAGGGCTGGGAGAGGG + Intronic
1134700517 16:16261399-16261421 CAGGAACAAGGGCTGGGAGAGGG + Intronic
1134971309 16:18533260-18533282 CAGGAACAAGGGCTGGGAGAGGG - Intronic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1137410084 16:48221039-48221061 ATTTTTAAAGGGCTGGGAGTGGG + Intronic
1138010906 16:53379299-53379321 CGGATTCCAGGGCTGGGATAGGG - Intergenic
1138201985 16:55095876-55095898 CGGTTTCAAGAGCTGCAAGAAGG - Intergenic
1138451531 16:57096007-57096029 CTGTTCTAAGTGCTGGGACATGG - Intronic
1140456560 16:75109177-75109199 CTGGTTCAAGGGCTCTGAGCTGG - Exonic
1140539535 16:75744000-75744022 CTTTTTCAAGGGGTTGGAGGTGG - Intronic
1141046462 16:80720018-80720040 CAGTGTCAAGGCATGGGAGAGGG - Intronic
1141621632 16:85239447-85239469 CTGCTTCAAGAGCTCTGAGAAGG + Intergenic
1141680904 16:85543268-85543290 CTGTTCCAGGGGCTAGGAGATGG + Intergenic
1141981978 16:87556509-87556531 CTGTTTCCAGGGCAGAGGGAGGG + Intergenic
1142023636 16:87800518-87800540 CTGCTTCAAGTCCTGGCAGAAGG + Intergenic
1142032324 16:87844708-87844730 GTGTTTCCAGGGCTGGGGCAGGG - Intronic
1142364554 16:89643187-89643209 CTGCTTCCAGGGCTGGGGCAGGG + Intergenic
1143041080 17:4036979-4037001 CTGATTCTAGGGCTAGGGGAGGG + Intronic
1143652102 17:8269478-8269500 CTGTTTCCTGGGCTGAGAAAGGG - Exonic
1145836800 17:27960532-27960554 GTGTTTCAAAGGCTTGGGGATGG + Intergenic
1146953107 17:36920328-36920350 GTGTTTCCAGAGCTGGGAGCTGG + Intergenic
1146966185 17:37032468-37032490 CTGATTTCAGGGCTGGAAGATGG - Intronic
1147577279 17:41610075-41610097 CTGACTCCAGGGCAGGGAGAAGG + Intronic
1147995257 17:44356563-44356585 CTGCACCAAGGGCTGGGAGCGGG + Exonic
1148435168 17:47678516-47678538 TTGCTTAAAAGGCTGGGAGAAGG + Intronic
1151075555 17:71268293-71268315 CTGTTTCTAGGGATGAGACAGGG + Intergenic
1151841228 17:76619197-76619219 CTGATTCCAGGGCTGGGGTAGGG - Intergenic
1152002331 17:77654565-77654587 CTTTTGCTTGGGCTGGGAGATGG - Intergenic
1152183771 17:78841224-78841246 CTGTCTCCCGGGCAGGGAGAAGG + Intronic
1152705628 17:81842082-81842104 CTGTGTGCAGGGCTGGGCGATGG - Intergenic
1203169415 17_GL000205v2_random:134550-134572 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1153254609 18:3157900-3157922 CTATTTGGAGGGCTGGGAGAGGG - Intronic
1154239292 18:12637745-12637767 CTGATTTCAGGGCTGGGACAGGG + Intronic
1155438269 18:25835046-25835068 CTGATTCCAGGGCTGAGACAGGG + Intergenic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1157495879 18:48157060-48157082 CCATTTCAAAGGGTGGGAGAGGG + Intronic
1159482108 18:69002796-69002818 TTGTTTCAATGGTTTGGAGAGGG - Intronic
1160349162 18:78159711-78159733 AGGTTTCTAGGGCTGGGCGACGG - Intergenic
1162468620 19:10858542-10858564 CTGTTTCCAGGGCTGCCATAAGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1162828626 19:13270093-13270115 CCGTATTCAGGGCTGGGAGATGG + Intronic
1162860971 19:13505795-13505817 GTCTTCCAGGGGCTGGGAGAGGG - Intronic
1162965163 19:14152087-14152109 ATGTTTCTGAGGCTGGGAGAGGG - Intronic
1163865718 19:19771654-19771676 TTGTTTCATGGCCTAGGAGATGG - Intergenic
1164014327 19:21239281-21239303 GTTTGTCAAGGGCTGGGAAAAGG + Intronic
1164606005 19:29598614-29598636 CTGTCTGAAGTGCTGGGACATGG - Intergenic
1165693739 19:37884611-37884633 GTGTTTCCAGAGCTGGGAAAGGG + Intergenic
1166133985 19:40764194-40764216 CTGTTTCAGGGGCTGTGAGTGGG + Intronic
1166210486 19:41303779-41303801 CTGTCATAAGGGCTGGGACAGGG + Intronic
1166866262 19:45839329-45839351 CTGATTCCAGGGCTGGGGCAAGG + Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167420415 19:49399374-49399396 GTGTTTTCAGGGGTGGGAGAAGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1168148083 19:54430583-54430605 CTGTTGGAAGGGGTTGGAGACGG - Exonic
1168312538 19:55468147-55468169 GAATTTCAAGGGCTGGGATAGGG - Intergenic
1168330090 19:55563147-55563169 CTGACTGAAGGGCTGGGAGCGGG + Intergenic
926178448 2:10617911-10617933 TGGTTGCAGGGGCTGGGAGAGGG + Intronic
926912269 2:17862199-17862221 CTGTTTCAAAGGCTTGGCGGTGG + Intergenic
927197820 2:20560204-20560226 GTGGTTCCAGGGCTGGTAGAAGG + Intergenic
927289341 2:21389518-21389540 CTGATTCTAGGGCTGAGATAGGG + Intergenic
927854771 2:26521107-26521129 CTGATTCAGTGGGTGGGAGAGGG + Intronic
928167731 2:28982818-28982840 CTGTTTCTTGGCCTGGGAGGTGG - Intronic
928623611 2:33116994-33117016 CTGTTGCAAAGACTGAGAGAGGG - Intronic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
929304734 2:40348114-40348136 TGTTTTCAAGGGCTGGAAGACGG + Intronic
929449896 2:42029908-42029930 CTGTTCCCTGGGCTGTGAGAAGG - Intergenic
929658731 2:43760799-43760821 CAGTTGCCAGGGCTGGGAGGAGG - Intronic
929779086 2:44946274-44946296 ATGGTTCAAGGGTTGGGAGCGGG + Intergenic
929850363 2:45582771-45582793 CTGATTCCAGGGCTGGGGCAGGG - Intronic
930759546 2:55018944-55018966 CTGATTCCAGGGCTGGGACACGG + Intronic
931325634 2:61219304-61219326 CTGATTTTAGGGCTGGGACAGGG - Intronic
931931744 2:67145530-67145552 GGGTTTCCAGGGCTGGGAGGAGG - Intergenic
932655049 2:73603166-73603188 GTGGTGCAAGAGCTGGGAGAGGG - Intronic
932663190 2:73674767-73674789 GTGGTGCAAGAGCTGGGAGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932993907 2:76825032-76825054 CTTTTTCAAGTGCTGGGATACGG + Intronic
934300643 2:91774277-91774299 CTGCATCCAGGGCTGGGAGGGGG + Intergenic
934717123 2:96550627-96550649 CTGTTTCCTGGGCTTGGAGGTGG - Exonic
934933737 2:98449564-98449586 CTGATTCCAGGGCTGGGACAAGG - Intronic
935080409 2:99787516-99787538 CTGTGGCAAGGGCTGGGAGCTGG - Intronic
937506607 2:122544439-122544461 CTATTTCAAGGGCCAGGAAAGGG + Intergenic
937608357 2:123828652-123828674 GTATTTCAAAGTCTGGGAGAAGG + Intergenic
938579329 2:132632154-132632176 CTGTTTCCAGGCCTGGCAGTGGG + Intronic
939690516 2:145254519-145254541 CTGTGTAAAGGGCTGCGAGTTGG - Intergenic
942539865 2:177004551-177004573 CTGTTTTAAGGGGTGTGAGGTGG - Intergenic
945539818 2:211071485-211071507 CTGTATGCTGGGCTGGGAGATGG - Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946373174 2:219292960-219292982 ATTTTTCCACGGCTGGGAGAGGG - Intronic
1170033488 20:11966638-11966660 CTGATTCAGGAGGTGGGAGACGG - Intergenic
1171004462 20:21450699-21450721 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
1171448257 20:25219572-25219594 CTGCTTCAGGGGCTGGGGCACGG + Intronic
1173739009 20:45382818-45382840 TTGTTGCCAGGGCTGGGAGTGGG - Intronic
1174035920 20:47668204-47668226 CTGAATCTAGAGCTGGGAGATGG - Intronic
1174216885 20:48922300-48922322 CTGTTTCTAGGACTTGGAGGTGG - Intronic
1174899048 20:54479370-54479392 CTATTTGAGGGGCTGGGGGAAGG + Intronic
1174940592 20:54922088-54922110 CTGATTCTAGGGCTGGGGCAGGG - Intergenic
1174972739 20:55295299-55295321 CTGTTTAATGGACTGGGAAATGG + Intergenic
1176130118 20:63493260-63493282 GTGGTTCAAGGGCTGGAAGGTGG - Exonic
1176306040 21:5123644-5123666 CTGTTTCAAGGGCAGGTTGGAGG - Intronic
1176332519 21:5561162-5561184 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176395238 21:6259789-6259811 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176402343 21:6324599-6324621 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176434814 21:6664505-6664527 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176441919 21:6729315-6729337 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1176459076 21:6991575-6991597 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1176466181 21:7056384-7056406 CTGTTTCATGGCATGGGGGAGGG - Intronic
1176489742 21:7438162-7438184 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1177253457 21:18627684-18627706 ATTTTTCAAGGGATAGGAGAAGG - Intergenic
1177840151 21:26227067-26227089 CTGTTTCCATGGGTGGGAAAGGG - Intergenic
1178387623 21:32166417-32166439 TTGATTCTAGGGCTGGGACAGGG + Intergenic
1178415072 21:32397795-32397817 CTGATTCTAGGGCTGGGACAGGG + Intergenic
1178780983 21:35603337-35603359 CTGTCTCAGAGGTTGGGAGAAGG + Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179495206 21:41766960-41766982 CGAGTTCACGGGCTGGGAGAAGG - Exonic
1179643662 21:42762519-42762541 CAGTTTCTTGGGCTGGAAGAGGG - Intronic
1179851017 21:44138387-44138409 CTGTTTCAAGGGCAGGTTGGAGG + Intronic
1180141786 21:45897669-45897691 CTGGTTCCAGGACTGGGACAAGG - Intronic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180816518 22:18792860-18792882 CTGCATCCAGGGCTGGGAGGGGG - Intergenic
1181202705 22:21227192-21227214 CTGCATCCAGGGCTGGGAGGGGG - Intronic
1181453091 22:23037116-23037138 TTGTTTTAAGGGCTGGGATCAGG - Intergenic
1181698997 22:24609413-24609435 CTGCATCCAGGGCTGGGAGGGGG + Intronic
1181947256 22:26527988-26528010 CTGGATCAAGGACAGGGAGAGGG - Intronic
1182129073 22:27837580-27837602 CTGTTGCTAGGCCTGGGGGAGGG + Intergenic
1182672179 22:32005637-32005659 AGGTTTCAGGGGCTGGGATAAGG - Intergenic
1183211202 22:36452485-36452507 CTGTATCAGGGTCTGGCAGAGGG + Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183413902 22:37671843-37671865 CCGTTTCCAGGCCTGGAAGATGG - Intergenic
1184640557 22:45867886-45867908 CTGTTTCCAGAGCTGGAAGGAGG - Intergenic
1203224208 22_KI270731v1_random:68221-68243 CTGCATCCAGGGCTGGGAGGGGG + Intergenic
1203266618 22_KI270734v1_random:18571-18593 CTGCATCCAGGGCTGGGAGGGGG - Intergenic
950323732 3:12083938-12083960 GTGTTTCATGGGTTGGGATAGGG + Intronic
950504482 3:13386028-13386050 GAGTGCCAAGGGCTGGGAGAGGG + Intronic
950621347 3:14207919-14207941 CTGATTCCAGGGCTGGGGCAGGG + Intergenic
952757480 3:36884362-36884384 TTGATTCCAGGGCTGGGACAGGG + Intronic
953332679 3:42066859-42066881 CTTTTTCAGGGGCTGGGGGGAGG + Intronic
953407592 3:42667157-42667179 CACTTTCCAGGGCTGGGGGAAGG + Intergenic
953861372 3:46546682-46546704 GTGTTTCTGGGGGTGGGAGAGGG - Intronic
953867935 3:46600194-46600216 CTGATTCCAGGGCTGGGACAGGG + Intronic
953958780 3:47251137-47251159 CATTTTCTAGAGCTGGGAGAAGG - Intronic
954332728 3:49899435-49899457 GTGTAGCAAGGGCAGGGAGAAGG + Intronic
955791323 3:62591424-62591446 CTTTTTGAAGGGTTGGGAGGTGG + Intronic
957141760 3:76368626-76368648 CCGTTTCAAGAGATGGGAAATGG + Intronic
957425667 3:80036023-80036045 CAGGTTAAAAGGCTGGGAGATGG + Intergenic
960432875 3:117591254-117591276 CTGATTCTAGGGCTGGGTCAGGG - Intergenic
960593861 3:119390821-119390843 CAGCTTCATGGGCAGGGAGAGGG - Exonic
960698733 3:120420112-120420134 CAGTTCCAAGGGCTGGCACAGGG + Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
961595317 3:128011361-128011383 CTGTTTCCAAGGCGGAGAGAAGG - Intergenic
962379687 3:134888073-134888095 CGTTTTCAAGGACAGGGAGAGGG - Intronic
963041510 3:141073626-141073648 CTGTTGCAAGGGCTGCTATAGGG - Intronic
964254707 3:154762846-154762868 CTGTTTCAAGGGTTGATATAAGG + Intergenic
964806895 3:160620043-160620065 CTGATTCTAGGGCTGGGGCAGGG - Intergenic
967826942 3:193884569-193884591 CTGTTTTCAGGCCTTGGAGAAGG - Intergenic
967873860 3:194253053-194253075 TTGTTTGCAGGGCTGGGACAGGG + Intergenic
968451293 4:677233-677255 CTGGTTCAAGGGGTGGGAGGAGG - Intronic
968593699 4:1472026-1472048 GTGTTTTAAGAGCGGGGAGACGG - Intergenic
969195421 4:5559508-5559530 CTGATTCTAGGACTGGGACAGGG + Intronic
969320508 4:6409688-6409710 GTGTCTCCAGGGCTGGGATATGG - Intronic
969550430 4:7862708-7862730 ATGTTTCAAGGGATAGCAGAGGG - Intronic
970803893 4:20007267-20007289 CTCTTTTAAGGGCTGGAAGTAGG - Intergenic
970876842 4:20881098-20881120 CTGCTTCTTGTGCTGGGAGATGG - Intronic
971311538 4:25529604-25529626 CTTTTTCTAGGGGTGGGAGAAGG + Intergenic
972869845 4:43284094-43284116 CTGGTCCAAGGACAGGGAGAGGG - Intergenic
973247589 4:48025926-48025948 CTGAATGAAGGGCAGGGAGAAGG - Intronic
975357472 4:73424923-73424945 CCATTTCTAGGGCTGGGAAAGGG - Intergenic
975666503 4:76739759-76739781 ATGTTCTAAGGGCTGGCAGAAGG - Exonic
976362212 4:84193486-84193508 CTGATTCTAGGACTGTGAGAAGG + Intergenic
979809095 4:125013143-125013165 CTGCTTAAAGGGCAAGGAGAAGG + Intergenic
980092907 4:128460833-128460855 CTATTTCATGGGTTGGGAAAGGG - Intergenic
980759667 4:137214110-137214132 CTAATTCAAGGGCTGGGACATGG + Intergenic
981153908 4:141412032-141412054 CTGATTCCAGGGCTGGGACAGGG - Intergenic
981509604 4:145541296-145541318 CAGTTGCAAGGGATGGGAGGAGG + Intronic
984227051 4:177047500-177047522 CTTTAGCAAGGGCTGTGAGAGGG + Intergenic
984342850 4:178481165-178481187 CTGTTTCTATGGCTGGGACTAGG - Intergenic
984986909 4:185340274-185340296 CTCTTACAGGGGTTGGGAGAGGG + Intronic
986182761 5:5408954-5408976 CTGTTTCATGTGCTGGGACATGG - Intergenic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
987231952 5:15903275-15903297 CTAATTCAGGGGTTGGGAGAAGG + Intronic
988596511 5:32597244-32597266 TGGTTACCAGGGCTGGGAGAAGG - Intronic
990491088 5:56303704-56303726 CTGGTCCAAGGCCTGGGAGATGG + Intergenic
991312903 5:65264525-65264547 CTGTTACATGGTCTGGGAGCAGG - Intronic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
996988486 5:129598528-129598550 CTGTTTCTTGGGCTGGGTGATGG - Intronic
997638274 5:135431265-135431287 AGGTTACAAGGGCTGGGGGAAGG + Intergenic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997673844 5:135697740-135697762 CTCTTTCAGGCCCTGGGAGAAGG - Intergenic
997896711 5:137725169-137725191 CTGTTTCACAGGCGAGGAGAGGG - Intronic
998385114 5:141753127-141753149 CTCTGTCAAGGGCTGGGAGCTGG + Intergenic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000344141 5:160300317-160300339 CTGCATCAAGGGCTGGATGAGGG - Intronic
1000986073 5:167861833-167861855 CTGTTTCAAATACTTGGAGAAGG - Intronic
1000987462 5:167876272-167876294 CTGAAACAAGGGCTGGGGGAAGG + Intronic
1001332125 5:170769841-170769863 CGGTTTCAAGAGCGGGGAAATGG + Intronic
1001730164 5:173947865-173947887 CTGATTCTTGGGCTGGGACAGGG + Intronic
1001783307 5:174389631-174389653 CTGTTTCTAACCCTGGGAGAGGG + Intergenic
1002531234 5:179846935-179846957 CCATTTCGACGGCTGGGAGAGGG - Intronic
1002591967 5:180296670-180296692 TTGATTCTAGGGCTGGGACAGGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002946496 6:1766344-1766366 CTGTTTCAGGTGCTGGGGAAAGG + Intronic
1003060209 6:2857165-2857187 CTGTTTCACAGGCCAGGAGACGG - Intergenic
1003704997 6:8516003-8516025 CATTTTCAAGGGGTGGGGGAAGG + Intergenic
1005279818 6:24261578-24261600 GTGTTTCATGGGCTCTGAGAGGG + Intronic
1006375775 6:33670990-33671012 CTGTTCCAATGCCTGGGAAAGGG + Intronic
1007180004 6:39923074-39923096 CTTTTTGAAGCACTGGGAGAGGG + Intronic
1007392535 6:41558349-41558371 CTGAACCAAGGGCTGGGAGAGGG + Intronic
1013062610 6:106651077-106651099 TGGTTACCAGGGCTGGGAGAGGG - Intronic
1013254383 6:108370015-108370037 CTGCTACAAGAGCTGGCAGAGGG + Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013422750 6:109980592-109980614 CATTTTCAAGGGCAGGGAAAAGG + Exonic
1016403560 6:143706213-143706235 CTGCTTCAAGAGCTGGGGCATGG - Intronic
1017056741 6:150443495-150443517 CTCTTTCCTGGGCTTGGAGATGG - Intergenic
1018232702 6:161690802-161690824 CCGTTTGAAGGCCTGGGAGCTGG - Intronic
1018684915 6:166296832-166296854 GTGTTTGAAGAGGTGGGAGAGGG - Intergenic
1018772510 6:166984276-166984298 CTGGCTCCAGAGCTGGGAGAGGG + Intergenic
1019878144 7:3834193-3834215 GTGTTTAAAGGGCAGGGAGTTGG - Intronic
1023024349 7:36037206-36037228 CATTGACAAGGGCTGGGAGAGGG + Intergenic
1023528020 7:41125598-41125620 CAGTTCCAAGAGCTGGGATATGG + Intergenic
1023584011 7:41710104-41710126 CTGTTTCAAGCCCAGGAAGAAGG - Intergenic
1023980916 7:45069484-45069506 CTCTTTCCTGGGCTGGGATAGGG + Intronic
1024407104 7:48994353-48994375 CTGTTTGATGGGCTGGGCCATGG - Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026292153 7:69017547-69017569 TGGTTGCAAGGGCTGGGAGTGGG - Intergenic
1028066602 7:86392048-86392070 CGGTTTCATGGGCTGGGCCAAGG - Intergenic
1028864045 7:95687523-95687545 ATGCTTAAAGGGGTGGGAGAAGG + Intergenic
1030279068 7:107751369-107751391 CTGGTCCAAGGCCTGGGAGTTGG + Intronic
1031300849 7:120059705-120059727 CTGCTGCAAGGGCTGAGGGAAGG - Intergenic
1031807874 7:126329152-126329174 CTGTTTCATGGGCTGGGACCAGG + Intergenic
1031864238 7:127020389-127020411 CTGGTTCAAGGTGAGGGAGATGG - Intronic
1032327344 7:130942542-130942564 CCGTTTCTTGGGCAGGGAGAGGG - Intergenic
1032686324 7:134237633-134237655 CTGATTCCAGGTCTGGGACAGGG - Intronic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033148029 7:138887912-138887934 GTTCTTCAATGGCTGGGAGATGG - Intronic
1033253041 7:139777398-139777420 TTGCTTCCAGGGCGGGGAGAGGG - Intronic
1034078211 7:148252576-148252598 CTATTTCAGGGTCGGGGAGAGGG + Intronic
1034144478 7:148856601-148856623 CTGATTCTAGGGTTGGGACAGGG + Intronic
1034388722 7:150764992-150765014 CTGATTCCAGGGCTAGGATAGGG + Intergenic
1034751851 7:153576297-153576319 TGGTTTCATGGGCTGGGTGAAGG + Intergenic
1034853386 7:154517088-154517110 ATGATCCAAGGGCTGGGAGATGG + Intronic
1035105325 7:156437202-156437224 CTGGTTCAAGGTTAGGGAGATGG - Intergenic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1036184732 8:6613468-6613490 CTGGTTTAGGGGCTGGGACATGG + Intronic
1036222116 8:6929716-6929738 CACTCTCAGGGGCTGGGAGATGG - Intergenic
1036476296 8:9096409-9096431 CTGGTTCAAGGCTTGAGAGAAGG - Intronic
1036923328 8:12879352-12879374 CTGGTTCAAGACCTTGGAGAAGG - Intergenic
1038325986 8:26573179-26573201 GAGTTTCAGGGGCTTGGAGAAGG + Intronic
1038539936 8:28384003-28384025 CTGTTTACAGGGCAGGGTGAAGG - Intronic
1041271331 8:56112033-56112055 CTGATGCAATGGCTGGCAGAGGG - Intergenic
1041527283 8:58821607-58821629 TGGTTGCCAGGGCTGGGAGAGGG - Intronic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1042554699 8:70024029-70024051 ATGTTTCAAGGGGTGGGAGTAGG + Intergenic
1044792867 8:95865529-95865551 CTGGTTCCAGGGCTGGGGAAAGG + Intergenic
1045478398 8:102573322-102573344 TTGTTTCAAGGGGTGGAAAATGG + Intergenic
1045659519 8:104422768-104422790 CTGCTTCAAGGGCTGGGACCAGG - Intronic
1047308556 8:123673261-123673283 CTGATTCTGGGGCTGGGAAAGGG + Intergenic
1047793300 8:128227976-128227998 TGGTTTCCAGGGGTGGGAGAAGG - Intergenic
1047803217 8:128331347-128331369 CTGTGTGAAGTGCTGGGAGTTGG + Intergenic
1048170870 8:132104925-132104947 CTGTCTCATGGTCTGGGAAAGGG + Intronic
1049849451 8:144823012-144823034 CGGTGACATGGGCTGGGAGAGGG - Intergenic
1050363216 9:4850871-4850893 CTGAAGCAAGGGCTGGGAAACGG - Intronic
1050485210 9:6126853-6126875 AGGTTTCAGGGGCTGGGAGAAGG + Intergenic
1050531204 9:6591202-6591224 CAGTCACAAAGGCTGGGAGAGGG - Intronic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1050651090 9:7777623-7777645 CTGTTTAAATGACTGGGAAAAGG - Intergenic
1055301503 9:74887572-74887594 CCGTTTCAAGAGCTGGGATGCGG - Intronic
1055456564 9:76477793-76477815 TTGTTTCCAGAGCTGGGGGAGGG - Intronic
1055775991 9:79767645-79767667 GTATTTCAAGAGGTGGGAGAGGG - Intergenic
1055829982 9:80366926-80366948 TTGCTCCAAGGGCTGGGAGTTGG + Intergenic
1056417235 9:86388499-86388521 CTGTGTCCAGGGCTAGGAGAGGG - Intergenic
1056673520 9:88652500-88652522 CTGTATCAAGTGGTGTGAGAAGG + Intergenic
1057097636 9:92326191-92326213 CACTTTCTAGGGCTGGGAGTAGG - Intronic
1057787994 9:98102661-98102683 CGTTACCAAGGGCTGGGAGAGGG + Intronic
1059431590 9:114253881-114253903 CAGTTTCAGGAGCTGGGTGAAGG + Intronic
1060073408 9:120570383-120570405 ATGTATCAAGTGCTGTGAGAGGG - Intronic
1060255944 9:122031305-122031327 CTGTTTAAAGGCCAGGGAGCAGG - Intronic
1060814216 9:126626318-126626340 CTGTTTTATGGGGAGGGAGAAGG + Intronic
1061604471 9:131698579-131698601 CTGTTAGAAGGGCGGGTAGAAGG + Intronic
1061650395 9:132043462-132043484 CTGTTTCATAAGCTGGGAGCAGG + Intronic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1061945767 9:133907580-133907602 ATGTTTTAGGGGATGGGAGAAGG + Intronic
1062597194 9:137304702-137304724 CTGTTCCAAATGCTGGGACACGG + Intergenic
1203429572 Un_GL000195v1:79170-79192 CTGTTTCATGGCATGGGGGAGGG + Intergenic
1203436722 Un_GL000195v1:144141-144163 CTGTTTCATGGCATGGGGGAGGG - Intergenic
1187058005 X:15759196-15759218 GTGTTTCAAGGGCTGAAAGAAGG + Intronic
1187078386 X:15959495-15959517 CTGATTCCAGGACTGGGACAGGG + Intergenic
1187318323 X:18219141-18219163 CTGTGGCAAGTGCTGGGCGATGG - Intronic
1188171968 X:26938589-26938611 CTGTTTGGAGGGCTGGGGGTGGG + Intergenic
1188331546 X:28878075-28878097 TTATTTTAAGAGCTGGGAGAGGG + Intronic
1188450182 X:30300960-30300982 CTGTTTCCAGGGCTGGAGCAAGG + Intergenic
1188513426 X:30960327-30960349 CTGATTAAAGGGCTGGAAGTAGG + Intronic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189261845 X:39684753-39684775 CTGTAACAATGGCTGGGTGATGG + Intergenic
1189291313 X:39887872-39887894 GTGTTTTCAGGGTTGGGAGAGGG - Intergenic
1189373433 X:40447758-40447780 GTGTCTCAAAGGCTGGGAGCTGG - Intergenic
1190021615 X:46883522-46883544 CTGATTTATGGGCTAGGAGAGGG - Intergenic
1190303887 X:49071777-49071799 CTGTTTTAAGTGCTGGGAAAGGG + Exonic
1190545638 X:51523572-51523594 CTGACTCAAGGGCTGGAACAGGG - Intergenic
1190746516 X:53326301-53326323 GTGTAGCAAGGGATGGGAGATGG + Intergenic
1192415321 X:70974683-70974705 CTGATTCCAGGTCTGGGACAGGG + Intergenic
1193086102 X:77448623-77448645 CTGTTTCTGGGACTGGGAGTGGG - Intronic
1194560711 X:95416252-95416274 CTGTTTCAAAGGATGCGGGAAGG - Intergenic
1195274010 X:103261452-103261474 CTGATCAAAGGGCTGGGAAAAGG - Intergenic
1195604917 X:106794541-106794563 CTGATTCTAGGGCTAGGAGAGGG - Intronic
1196118215 X:112019850-112019872 CTGTTGGAAGGGCTGGAAAATGG + Intronic
1197125343 X:122939359-122939381 CTGATTCAAGGGCTGGAGCAGGG + Intergenic
1197533282 X:127657590-127657612 GGGTTCCAATGGCTGGGAGAAGG - Intergenic
1197699557 X:129588568-129588590 CTGTTGACAGGGCAGGGAGAAGG + Intronic
1197703876 X:129619816-129619838 TTGAATCAAGGGTTGGGAGATGG + Intergenic
1198772931 X:140150047-140150069 CACTCTCAGGGGCTGGGAGATGG + Intergenic
1200034955 X:153321054-153321076 CTGTTGCAGGGGCTTGGATAGGG - Intergenic
1200144255 X:153918312-153918334 CTGTTTCTGGGGGTGGGAGCTGG + Intronic
1201075622 Y:10185193-10185215 CTCTGGCAAGGGGTGGGAGAAGG - Intergenic
1201453577 Y:14143477-14143499 ATGTTCCAAAGGCTTGGAGATGG - Intergenic
1202368977 Y:24184769-24184791 CATTTTCAAGGGCTGGCAGTGGG + Intergenic
1202501808 Y:25485348-25485370 CATTTTCAAGGGCTGGCAGTGGG - Intergenic