ID: 1091282906

View in Genome Browser
Species Human (GRCh38)
Location 11:134391968-134391990
Sequence GGTCCCCGTGGAGCACCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091282906_1091282915 22 Left 1091282906 11:134391968-134391990 CCGGCAGGTGCTCCACGGGGACC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1091282915 11:134392013-134392035 TTGACCTCGTCTTTACAATAGGG 0: 1
1: 0
2: 1
3: 9
4: 125
1091282906_1091282916 25 Left 1091282906 11:134391968-134391990 CCGGCAGGTGCTCCACGGGGACC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1091282916 11:134392016-134392038 ACCTCGTCTTTACAATAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 59
1091282906_1091282914 21 Left 1091282906 11:134391968-134391990 CCGGCAGGTGCTCCACGGGGACC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 1091282914 11:134392012-134392034 CTTGACCTCGTCTTTACAATAGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091282906 Original CRISPR GGTCCCCGTGGAGCACCTGC CGG (reversed) Exonic
900159890 1:1218559-1218581 GGGCACCGTGGAGAACCAGCAGG - Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900365530 1:2310594-2310616 GGCCCCCGTGGAGGCCCAGCCGG - Intergenic
902503281 1:16924398-16924420 GTCCCGCGTGGAGGACCTGCTGG + Exonic
904857990 1:33514520-33514542 GATGCTCGAGGAGCACCTGCTGG - Exonic
906117003 1:43363755-43363777 GGTCCCTGTAGAGCAGCTGTGGG + Exonic
907388779 1:54142827-54142849 CAGCCCCCTGGAGCACCTGCTGG + Intronic
912576166 1:110674623-110674645 GGTGCCCGGGGACCACCTGCTGG - Exonic
913108578 1:115638848-115638870 TGTCCCAGAGGGGCACCTGCCGG + Intergenic
913412130 1:118563730-118563752 GGTCCCCCTGGAGAACCTCCAGG - Intergenic
914765803 1:150636689-150636711 GGTCCCCATGGAGCAGCGGAAGG - Intergenic
915553996 1:156651336-156651358 CTTCCCTGTGGAGCACCTACTGG - Intronic
915980312 1:160416131-160416153 GGCTCCCGGGGAGCCCCTGCTGG + Exonic
916168130 1:161981365-161981387 GGTGCCCGTGGGGCCCCTTCAGG + Intergenic
917906731 1:179592288-179592310 GGTTCCCGAGGAGCCCCTGAAGG + Intronic
921168698 1:212526392-212526414 AGTTCACGTGAAGCACCTGCAGG - Intergenic
921188551 1:212690372-212690394 GGGGCCCGTGGGGCACCTGTCGG - Intronic
921484777 1:215703189-215703211 TGTCCCAGAGGGGCACCTGCCGG + Intronic
922955673 1:229597360-229597382 GATCCCTGGGGAGCACCAGCTGG - Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1063109302 10:3020729-3020751 GTTCCCAGAGGAGCAGCTGCAGG - Intergenic
1067048584 10:42999609-42999631 GGTCCCCCTGGAGCTCCTAGGGG - Intergenic
1067060208 10:43074541-43074563 GGTCCCCTTGGAGAATCTTCAGG - Intergenic
1067064707 10:43097230-43097252 GGCCCCAGAGGAGCACCTGTGGG + Intronic
1067178768 10:43969628-43969650 GGTCAGCGTGGGGCAACTGCTGG + Intergenic
1067369740 10:45672473-45672495 GGTCCCCGGGCAGCAGCGGCCGG + Intronic
1067567926 10:47351448-47351470 GGTCTCCGGAGAGCATCTGCAGG - Exonic
1068951654 10:62783070-62783092 CGTCCCAGAGGGGCACCTGCCGG - Intergenic
1072074382 10:91954512-91954534 GGTCCTCGAAGAGCACCTGAAGG - Intronic
1074974631 10:118570007-118570029 TGTCCCCATGGAGAACCAGCTGG - Intergenic
1075398509 10:122144514-122144536 GGTCCTCAGGGAGCTCCTGCTGG + Intronic
1075598997 10:123753405-123753427 GGACCCTGAGGGGCACCTGCAGG + Intronic
1075807378 10:125199748-125199770 GGTCCCTGTGGGGCCACTGCAGG - Intergenic
1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG + Exonic
1076780664 10:132722672-132722694 CGTCGCGGTGGAGCAGCTGCTGG + Intronic
1076887609 10:133269749-133269771 GGTCTCTGTGGAGCCCCTGTCGG - Intronic
1077185865 11:1235072-1235094 TGGCCCCTTGCAGCACCTGCAGG + Exonic
1077256247 11:1584752-1584774 GGCCCCCTTGGAGCACCCACAGG + Exonic
1078087720 11:8244125-8244147 GCTCCCTGTGAAGCCCCTGCAGG - Intronic
1081981920 11:47272270-47272292 GCTCCCAGTAGAGGACCTGCAGG - Intronic
1082810433 11:57476266-57476288 GGTTCCCGTGCAGCAGCAGCCGG - Exonic
1083755675 11:64790421-64790443 TGTCCACCTGGATCACCTGCTGG + Exonic
1086437040 11:86791775-86791797 GCTCCCCGTGGCACACCTGATGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1091449386 12:563004-563026 GGAGCCCGTGGAGAACCTTCTGG + Exonic
1094835937 12:34322116-34322138 GGGCCCCATGCAGCAGCTGCTGG + Intergenic
1095983689 12:47986367-47986389 GGTGCCCGTGGAGAGCCTGGTGG - Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096263549 12:50107177-50107199 TGTCCCCCTGGACCACCTCCTGG - Intronic
1096454592 12:51774546-51774568 AGTCCCCCTGGAGCAAATGCAGG - Intronic
1100759199 12:97788139-97788161 GGTCCATGTGCAGAACCTGCAGG + Intergenic
1101604690 12:106239377-106239399 CGTCACCGTAGAGCACCAGCTGG + Exonic
1101747938 12:107558369-107558391 GGGCATCCTGGAGCACCTGCAGG - Intronic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103939956 12:124496167-124496189 GGTCCCCGTGGCTCCCTTGCTGG - Intronic
1104036782 12:125103116-125103138 GGACCCACTGGAGCTCCTGCGGG + Intronic
1104967355 12:132514269-132514291 GGTCTCCCTTGGGCACCTGCGGG - Intronic
1109142393 13:58730644-58730666 TGGCCCCTTGGAGCAGCTGCTGG + Intergenic
1114523346 14:23352406-23352428 GGTGCCCACGGAGCAGCTGCAGG - Exonic
1114727668 14:24955718-24955740 GGTCTCCATGGAGAACTTGCTGG - Intronic
1117299168 14:54407221-54407243 CGTCCCAGAGGGGCACCTGCCGG + Intronic
1120932885 14:89866475-89866497 GGGCCCCCTCCAGCACCTGCAGG + Intronic
1121616491 14:95317176-95317198 GCTCGGCGTGGAGCACCTTCTGG + Intronic
1121729665 14:96177634-96177656 GGAGCCCTCGGAGCACCTGCTGG + Intergenic
1122115707 14:99526308-99526330 AGGCCCCGTGCAGCTCCTGCAGG + Intronic
1125522100 15:40354022-40354044 GGCCACCATGGAGCACCTCCAGG + Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1130395067 15:83494304-83494326 GGTGGCCATGGAGAACCTGCAGG + Intronic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1132580417 16:682260-682282 GGACATCGAGGAGCACCTGCAGG + Exonic
1132645906 16:999171-999193 GCTCCCGGTGGAGCAGCTTCTGG + Intergenic
1132665369 16:1078994-1079016 GGTGCCCGTGCTGTACCTGCTGG + Exonic
1132723041 16:1326300-1326322 GGTCCCCGTGGCCCAAGTGCAGG + Exonic
1132884883 16:2178303-2178325 GCTCCCCGTGCAATACCTGCTGG - Exonic
1132934414 16:2473624-2473646 GCTGCCCGTGGAGGACCTGAGGG - Intronic
1132996386 16:2825675-2825697 GGCCCCCGTGGGGCACTTCCTGG + Intronic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1136714125 16:32263527-32263549 GGACACCGTGGAGTCCCTGCGGG + Intergenic
1137692718 16:50440778-50440800 GGTTCCTGTGGAGAACCAGCAGG + Intergenic
1141596250 16:85098591-85098613 GGCCCCCGTGGAGGACCTCAGGG - Exonic
1141636353 16:85315975-85315997 GGTGCCCATGGTGCCCCTGCTGG + Intergenic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1141949155 16:87329673-87329695 AGACCCCGAGGCGCACCTGCTGG - Exonic
1142419416 16:89961310-89961332 GGTCACTGAGGAGCACCTGGAGG + Intronic
1203055930 16_KI270728v1_random:926242-926264 GGACACCGTGGAGTCCCTGCGGG - Intergenic
1143918557 17:10312946-10312968 GGTCCCTAAGGAGCACCTCCAGG + Intronic
1144048937 17:11480819-11480841 GGTCCCCGAGGAGAACCTAATGG + Intronic
1145939892 17:28737812-28737834 GGTCCCCGGGGGATACCTGCAGG - Exonic
1146400796 17:32498490-32498512 AGTCCTTGTGGAGCACCTGGAGG - Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147458270 17:40552217-40552239 TGTCCCCGAGGGGAACCTGCCGG - Intergenic
1148204999 17:45774626-45774648 GATCCCCGTGGAGGAAATGCAGG - Intergenic
1150292903 17:63992002-63992024 GGCCCCCGAGGAGCAGCTTCAGG - Intergenic
1151653354 17:75483789-75483811 GGTCCCTGTGAAGCAGCTGTAGG + Intronic
1152599556 17:81255117-81255139 GGTCCCTTTGGAGAACCTCCCGG + Intronic
1152706695 17:81847293-81847315 GGTCACCAAGGAGAACCTGCTGG - Exonic
1152725266 17:81942003-81942025 GTCCCCTGTGGAGCCCCTGCCGG + Intronic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1157478237 18:48036830-48036852 GGTCCCCGTGGAAAGGCTGCAGG + Intronic
1159957012 18:74525903-74525925 AGTCCCTGTGGAGAACTTGCTGG + Intergenic
1161801042 19:6416854-6416876 GGACCCCCTGGAGGACCTGGGGG + Exonic
1161984752 19:7647161-7647183 GGACGCCGTGGAGGACCGGCTGG + Exonic
1163464065 19:17455922-17455944 GTTCTCAGTGGAGCGCCTGCCGG - Exonic
1165041007 19:33067396-33067418 GGTCCTGGGGCAGCACCTGCAGG - Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166378945 19:42344513-42344535 GGTCCCCGTGGAGGGGCTGTGGG - Exonic
1167254609 19:48419655-48419677 GGTGCCCGTGGAGAACCCCCGGG + Exonic
1167490430 19:49789870-49789892 GATCCCAGGGGAGCACCTTCTGG - Intronic
925910666 2:8571748-8571770 GGTCAGCGTGGGGCAGCTGCTGG - Intergenic
926196365 2:10765837-10765859 GGGCCCCCTGGAGCACATGGAGG + Intronic
926886335 2:17602167-17602189 GTGGCCCATGGAGCACCTGCGGG + Intronic
934754746 2:96817087-96817109 GCTGCCCGTGGGGCAGCTGCTGG + Exonic
935736833 2:106112654-106112676 GCTCCCCCTGGAGCGCCTGCAGG + Exonic
945533682 2:210986594-210986616 CGTCCCAGAGGGGCACCTGCCGG + Intergenic
947542208 2:230987055-230987077 GGTCCCCTTTGAGCCCCTGGAGG + Intergenic
948450716 2:238069440-238069462 GCTGCCCCTGGAGCACCTGGTGG + Exonic
1169426650 20:5502253-5502275 GGTCCTGGTGGAGCACTTCCAGG - Intergenic
1169808130 20:9580388-9580410 GCTCTCCTTGGAGCACCCGCTGG + Exonic
1172013004 20:31857275-31857297 GATCCCCCTGGAGGACCTCCTGG - Intronic
1172129185 20:32644563-32644585 AGTCCCCTGGGGGCACCTGCAGG + Intergenic
1173982940 20:47239005-47239027 GGTGACCGTGGAGGACGTGCTGG + Exonic
1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG + Intergenic
1175384680 20:58586741-58586763 AGTCACCCTGGAGCACCTCCAGG + Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176111176 20:63411461-63411483 GGCCCCCGGGCAGCACCTCCAGG - Intronic
1176125762 20:63473760-63473782 GGTCCCTCTGGAGCTGCTGCTGG + Intergenic
1178119677 21:29456283-29456305 GGTCCCCATGGGGTCCCTGCAGG - Intronic
1179605782 21:42514293-42514315 GGACTCCGTGGAGCGGCTGCCGG - Exonic
1179888559 21:44324855-44324877 GGTCAACGTGGAGCACATGACGG + Exonic
1179900595 21:44391496-44391518 GGGCCACGTGGTGCATCTGCAGG - Exonic
1181689221 22:24549095-24549117 GGTCCCTGAGCAGCCCCTGCAGG - Intronic
1183080704 22:35454269-35454291 GGTCCTCCTGGAGCTCCTGATGG + Intergenic
1183105276 22:35610883-35610905 GATCCCCGTGAAGTACCTGGAGG - Exonic
1183425127 22:37735085-37735107 GGGCCTCTTGGAGCTCCTGCAGG + Exonic
1184368514 22:44068037-44068059 GCCCCGCCTGGAGCACCTGCTGG + Intronic
949930907 3:9077712-9077734 GGTGTGCATGGAGCACCTGCTGG + Intronic
950419879 3:12892546-12892568 GGTCCCTGTGGAGGTCCTGGGGG - Intergenic
950742768 3:15063420-15063442 GGTCCCAGTGGGGCAGCTGAAGG + Intronic
953117627 3:40008904-40008926 GGACTCAGTGGTGCACCTGCTGG - Intronic
953782972 3:45887765-45887787 GGGCCCTGTGCAGCCCCTGCTGG + Intronic
954707296 3:52487889-52487911 GGTCCGCGTGGAACTCGTGCAGG - Exonic
954861593 3:53695168-53695190 GGTCCCCGTGGAGGAGGTGCTGG + Intronic
961433220 3:126897975-126897997 GGTCCTCATGGAGACCCTGCAGG - Intronic
961793461 3:129393073-129393095 GATCCCCCAGGAACACCTGCAGG + Intergenic
961807458 3:129499691-129499713 GATCCCCCAGGAACACCTGCAGG + Intronic
965983394 3:174721772-174721794 GGGTCACGTGGAGCACCAGCTGG + Intronic
966905806 3:184525397-184525419 AGTCCCCGAGGATCACCTGCGGG - Intronic
968046129 3:195624761-195624783 GGGCTGCGCGGAGCACCTGCAGG - Intergenic
968308525 3:197665326-197665348 GGGCTGCGCGGAGCACCTGCAGG + Intergenic
968373006 4:12223-12245 GGTGCCCGTCCACCACCTGCTGG + Intergenic
968503836 4:963038-963060 GATCCCCGTGGAGCTCCTGCCGG + Intronic
968533942 4:1112609-1112631 GGTCCGCCTGGAGGACCTGGGGG - Intronic
968613058 4:1565747-1565769 TGTCCCCATGGGGCACCTGCGGG - Intergenic
968867126 4:3220241-3220263 GATCCCCGTGGAGTTCCTCCAGG + Exonic
969646333 4:8431643-8431665 GGTCCACGTGCAGCTCCTGGTGG - Intronic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
971103514 4:23496637-23496659 GCTCCCCATGGAGCACCTTGTGG + Intergenic
973322379 4:48823520-48823542 GGTACATGTGGAGAACCTGCAGG - Intronic
973777704 4:54258193-54258215 GGAACCCTTGGAGAACCTGCTGG - Intronic
975538944 4:75484182-75484204 GGTCCCCTTGGTGCTCCTGGCGG - Intronic
985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG + Exonic
985462389 4:190120344-190120366 GGTGCCCGTCCACCACCTGCTGG - Intergenic
985798657 5:1985878-1985900 AGTCCACCTGGAGCATCTGCTGG - Intergenic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1002108700 5:176893525-176893547 GGGCCACGAGGAGCACCAGCTGG + Intronic
1002421165 5:179149812-179149834 GGTTCCCGAGGAGCACAGGCTGG - Intronic
1005947098 6:30602670-30602692 GGTCCCCATGGAGGCCCTGGTGG - Exonic
1008369394 6:50715382-50715404 GCTCCCCGTGGTGGATCTGCTGG - Exonic
1011627578 6:89296178-89296200 GGACACCCAGGAGCACCTGCAGG + Intronic
1015244576 6:131062719-131062741 GGGCCCCGTGGAGCAACAGCGGG - Intronic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1015867420 6:137741151-137741173 GGTTCCCGTGTAGTTCCTGCTGG - Intergenic
1017537410 6:155363349-155363371 GGAGCCCGTGGAGCTCCTGGGGG - Intergenic
1018588857 6:165394100-165394122 GGTCCACGTGCAGAACGTGCAGG + Intronic
1019529469 7:1496264-1496286 AGACCCCGTGCTGCACCTGCAGG - Exonic
1019618042 7:1975377-1975399 GCCCACCGTGGAGAACCTGCTGG - Intronic
1020270245 7:6590409-6590431 GGGCCCCGTGGAGCTGCTGGAGG + Exonic
1020445510 7:8262573-8262595 TGGCCACGTGGAACACCTGCCGG - Intronic
1026592938 7:71712242-71712264 GGGGCCCATCGAGCACCTGCCGG - Exonic
1026916016 7:74120853-74120875 GGGCCCCCTGGAGTAACTGCCGG + Intronic
1029552521 7:101244959-101244981 GGTGTCTGTGGAGGACCTGCTGG - Exonic
1030386690 7:108875110-108875132 GGTCCCTCTGGTGCAGCTGCAGG - Intergenic
1031840681 7:126735825-126735847 AGTCCCATTTGAGCACCTGCAGG + Intronic
1032383636 7:131506854-131506876 GGCCTGCGTGGAGCACCAGCTGG - Intronic
1032427683 7:131834597-131834619 AGGCCCCGTGGAGAACCTGGGGG + Intergenic
1034893836 7:154862624-154862646 GTGCCTCGAGGAGCACCTGCAGG + Intronic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1045505227 8:102773501-102773523 GATGCCTGTGGAGCCCCTGCTGG - Intergenic
1045911268 8:107413286-107413308 GGTCCCCTTGGAACAGCTTCAGG + Intronic
1050538988 9:6653869-6653891 GATCCCCGTGGATCACCTGACGG - Intergenic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1061263508 9:129492700-129492722 ACTCCCCGTGGAGGTCCTGCAGG - Intergenic
1062151534 9:135021683-135021705 GGACACCATGGAGCAGCTGCTGG + Intergenic
1062348084 9:136124701-136124723 GGGCCCCTCGGAGCCCCTGCGGG + Intergenic
1062413466 9:136436284-136436306 GGTGACCGAGGAGCCCCTGCTGG - Intronic
1185449668 X:275604-275626 GGTGCGTGGGGAGCACCTGCGGG + Intergenic
1187308453 X:18118565-18118587 TATCCCCTTGGTGCACCTGCTGG + Intergenic
1187826236 X:23335022-23335044 GGAGAGCGTGGAGCACCTGCTGG + Exonic
1192533757 X:71911243-71911265 GGACCTCGAGGGGCACCTGCTGG + Intergenic
1195536521 X:106014210-106014232 GGCCCACGTGTGGCACCTGCTGG + Intergenic
1201406080 Y:13651932-13651954 TGTCCCACAGGAGCACCTGCCGG + Intergenic