ID: 1091283172

View in Genome Browser
Species Human (GRCh38)
Location 11:134393866-134393888
Sequence CAGTGCCCCCAAAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091283163_1091283172 29 Left 1091283163 11:134393814-134393836 CCTGCTGGTTAAGACAGCTGCTG 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091283172 Original CRISPR CAGTGCCCCCAAAGAGAGGG AGG Intronic
900351017 1:2234598-2234620 CAGGGCCTCCAGAGAGAAGGCGG + Intronic
900459675 1:2796875-2796897 TGGTGACCCCAACGAGAGGGTGG - Intronic
903819955 1:26094520-26094542 CAGTGCCCCTGAAGAGAATGAGG + Intergenic
904078771 1:27858850-27858872 CAGTGACCCAAAGGAGAGGGAGG - Intergenic
905732529 1:40306504-40306526 CAGTACCCCCACAGGGAGGGAGG + Intronic
905862960 1:41362622-41362644 CTATGCCCCCAAGGACAGGGTGG - Intronic
906165322 1:43681691-43681713 AGGTGCCCCCAAAGTGATGGCGG + Intronic
906346001 1:45014815-45014837 CAGTGGCCCCAAAGAAAGCCCGG + Exonic
906647079 1:47482999-47483021 CTGTGGCCCCAGAGAGTGGGAGG + Intergenic
907266425 1:53264356-53264378 CAGTGACCCGAAAGAGCAGGAGG - Exonic
908767371 1:67566175-67566197 CAGTGGCCCCAAAGATAGTCAGG + Intergenic
912528752 1:110304811-110304833 CCGTGCCCCAAAGGGGAGGGAGG + Intergenic
915605458 1:156947537-156947559 CAGTTCCCCCAAAAATAGAGTGG - Intronic
917060529 1:171032910-171032932 CTGAGCCCCTAAGGAGAGGGAGG - Intronic
920961082 1:210664687-210664709 CAGTGGATCCAAAGAGATGGTGG + Intronic
921249153 1:213280249-213280271 CAGTTCCCCCAAAGAGATTCAGG + Intergenic
1063909076 10:10811462-10811484 CAGTTCTCCCACAGAGATGGGGG + Intergenic
1064199102 10:13269809-13269831 AAGTGCTCCCAAAGTGAGGCGGG - Intergenic
1064687102 10:17874223-17874245 CAGAGCCCCTAAAGGGAGCGTGG - Intronic
1065292208 10:24242034-24242056 CAGTGCCCCCAAACAGTGCTGGG - Intronic
1067175473 10:43943007-43943029 AAGTGCCACCCAACAGAGGGTGG + Intergenic
1067720708 10:48725699-48725721 CAGAGCCCCCTAGGAAAGGGTGG - Intronic
1068192279 10:53667442-53667464 CAGTCTCCACAAAGACAGGGTGG - Intergenic
1069055168 10:63837312-63837334 CTGTCCCCCCAAAGAGGTGGTGG - Intergenic
1069854127 10:71430101-71430123 CAGTGACCCCAGTGAGGGGGTGG + Intronic
1069888460 10:71638463-71638485 CTGGGCCCCCAAAGGGAGGGAGG - Intronic
1070500604 10:77069575-77069597 CATTACCCCCAAAGATATGGGGG + Intronic
1072551089 10:96478177-96478199 GAGAGACCCCAAAGAGAGGCAGG - Intronic
1072880189 10:99219127-99219149 CAATGCACCCAGTGAGAGGGAGG - Intronic
1073462479 10:103674010-103674032 CAGTATTCCCAAAGAGAGAGAGG - Intronic
1073540441 10:104313069-104313091 CAGTGCCCACACAGAAGGGGTGG + Exonic
1075402938 10:122173848-122173870 CTGTGCCCCCAGAGAGGGGCTGG - Intronic
1076688507 10:132208901-132208923 CAGAGTCCCCAAAGAGAGCAGGG + Intronic
1077633647 11:3827351-3827373 CAGTGTTCCCAAGCAGAGGGGGG + Exonic
1078594569 11:12674915-12674937 CAGAGCCCGCAAAGAAAGAGCGG - Intronic
1080147774 11:29008140-29008162 AAGTGCCCCCAAAGAGACTTGGG - Intergenic
1082110017 11:48264163-48264185 CAGTGCCACCAAAGAAATGGAGG - Exonic
1082874846 11:57977780-57977802 CAGTGCTCACAAAGTGAGTGTGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084954546 11:72684419-72684441 CTGAGCCCCCGAAGAGCGGGTGG + Intergenic
1086451276 11:86919366-86919388 CAGTGCCCACAACGAGAGAGTGG - Intronic
1090344769 11:126061532-126061554 CAGTGTCTCCAAGGAGAGGAAGG - Intronic
1091225318 11:133953622-133953644 CAGTGTCCCCAAATACAGTGAGG - Intronic
1091283172 11:134393866-134393888 CAGTGCCCCCAAAGAGAGGGAGG + Intronic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1096486464 12:51985316-51985338 CATTGCCCCGAATCAGAGGGTGG + Exonic
1096692213 12:53328265-53328287 CAGTGGCCCCAAGGAGCTGGGGG - Exonic
1097261908 12:57725244-57725266 CACTGCCTCCAAGGAGATGGGGG + Intronic
1102559753 12:113753815-113753837 CAGTGCCCCCAGAGAGCAAGGGG + Intergenic
1104390245 12:128385961-128385983 CAGTGCTCCCACAGAGAGCTGGG + Intronic
1109064813 13:57673365-57673387 CAGTGCCCCTAAACAAAGGCTGG - Intronic
1110393178 13:74999671-74999693 CTGTGCCCCCAAAGTTAGAGTGG - Intergenic
1110904834 13:80873738-80873760 CACTGACACCACAGAGAGGGTGG - Intergenic
1113498612 13:110755048-110755070 CAGTGGCACAAAGGAGAGGGTGG + Intergenic
1113862815 13:113500906-113500928 CAGTGCCCTCCAAGAAGGGGTGG + Intronic
1114759772 14:25300576-25300598 CAGTGACCACAAAGATAGGTAGG - Intergenic
1117672933 14:58126093-58126115 CAGAGCTCCCATACAGAGGGAGG - Intronic
1119068485 14:71555780-71555802 TAGAGAGCCCAAAGAGAGGGAGG + Intronic
1121249229 14:92487455-92487477 CAGTGCCCAAAGAGAGAGGTTGG + Intronic
1122254257 14:100465008-100465030 CAGCTCTTCCAAAGAGAGGGTGG - Intronic
1125434898 15:39634136-39634158 CAGTGACGCAAAAGAGAGTGGGG - Intronic
1126127460 15:45308764-45308786 CAGTGCCCCTAAAGAGAAATAGG + Intergenic
1126668983 15:51099221-51099243 CACTGCCCACAAAGAAAGTGTGG - Intronic
1127619226 15:60716974-60716996 AATTGAACCCAAAGAGAGGGTGG + Intronic
1128391693 15:67186883-67186905 CAGTGCCCCCAGAGACGGGCTGG - Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1132627087 16:896384-896406 CTGTGCCCCCAACGACAGGGAGG + Intronic
1132682759 16:1150130-1150152 CAGAGCCCCCAAGGACAAGGTGG + Intergenic
1136455055 16:30375756-30375778 CATTGCCCCCAGAGAGGTGGAGG + Intronic
1137768680 16:50997142-50997164 CAGTGCCCCAAAGGACAGGCCGG - Intergenic
1139158832 16:64478269-64478291 CAGTGCATCCACAGACAGGGAGG - Intergenic
1139596395 16:67960782-67960804 CAGTCACCCCAAAGAGAAGAGGG + Intronic
1141544044 16:84751372-84751394 CATTTCCCCCAAGGAGCGGGGGG - Intronic
1141766119 16:86060978-86061000 CAGTGCCCACAAAGCGAGGCTGG - Intergenic
1142012113 16:87720826-87720848 CAGTGTCCCCAAAGAGGCTGCGG - Intronic
1142228619 16:88889104-88889126 CTGTGTCCCCAAAGACTGGGAGG + Intronic
1142469107 17:152875-152897 CTGTGCCCCAGAAGAAAGGGAGG - Intronic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143864979 17:9917123-9917145 CAGTGGCCCAGGAGAGAGGGTGG + Exonic
1144408283 17:14974134-14974156 CTGTGCACCCAAAGAGATGAAGG + Intergenic
1146225489 17:31062503-31062525 AATTTCCCCCAAATAGAGGGAGG - Intergenic
1146557789 17:33841678-33841700 CAGAAGCCCCCAAGAGAGGGAGG + Intronic
1146587559 17:34095357-34095379 CAGTGCCATCAAAGACAGGCTGG + Intronic
1146729347 17:35180835-35180857 CAGGGCCCCTACAGGGAGGGGGG - Intronic
1147127107 17:38378670-38378692 CAGTGCTCCCAAATGGAGAGAGG - Intronic
1147390118 17:40103889-40103911 CAAAGCCACCAAAGGGAGGGGGG + Intergenic
1147742205 17:42675900-42675922 CGGGGACCCCAAGGAGAGGGAGG - Intronic
1148715154 17:49710785-49710807 CAGCTCCTCCAATGAGAGGGAGG + Exonic
1149274563 17:55018457-55018479 CAGAGCTCCCATAGAAAGGGAGG + Intronic
1151970705 17:77456143-77456165 CAGTGGCCCCATTGAGTGGGAGG + Intronic
1152016825 17:77756311-77756333 CAGGGCCTCCAAAGGGAGTGAGG + Intergenic
1152322371 17:79614911-79614933 TAGGGCCCCCAGAGAGAAGGAGG + Intergenic
1152461461 17:80444493-80444515 CAGTGCCCCCACTGATATGGGGG - Intergenic
1152588770 17:81200840-81200862 CCGTGGCTCCACAGAGAGGGTGG + Intronic
1152610684 17:81313838-81313860 CAGTCCCCCCAAGGAGACCGAGG + Exonic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1157451791 18:47794483-47794505 CAGTGCCCCTGGAGCGAGGGGGG + Intergenic
1157790898 18:50529971-50529993 CACTGCTCCCACAGAGGGGGTGG - Intergenic
1158032585 18:52984307-52984329 AAGTCCCTCCAAAGAGTGGGAGG + Intronic
1160857072 19:1222431-1222453 CAGAGCCCACGAAGTGAGGGAGG - Intronic
1161200587 19:3012639-3012661 TTGAGCCCCCACAGAGAGGGAGG + Intronic
1163411019 19:17154536-17154558 CAGTGCCGCCATAGGGAGTGTGG + Intronic
1163831748 19:19550429-19550451 CAGGGCCCCGAGAGAGTGGGAGG - Intergenic
1164413015 19:28021215-28021237 AAATGCCTCCACAGAGAGGGAGG + Intergenic
1164509153 19:28883362-28883384 GAGGTCCCCAAAAGAGAGGGAGG - Intergenic
1164517510 19:28948629-28948651 AAATGCCTCCACAGAGAGGGAGG + Intergenic
1165686430 19:37825004-37825026 CAGGGCCCCAAAAGGCAGGGTGG - Intergenic
1165985386 19:39764329-39764351 CAGTACACCCTAAGAGAGAGAGG + Intergenic
1166267071 19:41690918-41690940 CAGGGCCTTCTAAGAGAGGGGGG - Intronic
1167314631 19:48756459-48756481 CAGAGCCCCGAAAGTGAGTGTGG + Exonic
1168123936 19:54272485-54272507 CAGGGCCCTCACAGACAGGGAGG + Intronic
1168643456 19:58045009-58045031 CAGCGCCCCCGCAGAGATGGTGG + Intronic
925587936 2:5482152-5482174 ATGTGCCCCCAGAGAGAGAGAGG - Intergenic
927054058 2:19353983-19354005 CACTGCCCTCACAAAGAGGGTGG + Intronic
928415085 2:31085334-31085356 AAGGGCCTCCAGAGAGAGGGAGG + Intronic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
929474932 2:42236798-42236820 CAGTGTTCCCAAAGATATGGAGG - Intronic
930187026 2:48420567-48420589 CTGTGCCCCTGCAGAGAGGGGGG + Intergenic
932310247 2:70734058-70734080 CAGTGTCCCCGGGGAGAGGGGGG - Intronic
933500194 2:83101657-83101679 CAGAGCCCCCATACAAAGGGAGG - Intergenic
934707873 2:96497393-96497415 CAGTGCCCCAAAATCAAGGGTGG + Intergenic
935237210 2:101149655-101149677 CACTGCCCTCAAAGAAAGGGAGG + Intronic
938017626 2:127880610-127880632 CAGCGTCCCCACAGAGAGGGAGG - Intronic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
940786729 2:157989425-157989447 CAGGGAGCCCACAGAGAGGGGGG - Intronic
940991063 2:160097326-160097348 CAATGACACCAAAGAGTGGGGGG + Intergenic
942053139 2:172159080-172159102 CAGTGCCCCCAAACAGTGCCTGG - Intergenic
946378260 2:219327339-219327361 CAGAGCCTCCAAACAGAGGGAGG - Intergenic
947732588 2:232439494-232439516 CACTGCTCCCCAGGAGAGGGAGG + Intergenic
948899270 2:240947923-240947945 CTGGGCCCCCAAGGAGAGAGAGG + Intronic
948980142 2:241490313-241490335 CAGTGCCTCCAAAGACAGGACGG + Intronic
1168923258 20:1558493-1558515 AAATGCCCCCAGAAAGAGGGAGG + Exonic
1170101186 20:12701117-12701139 CAGCTCCCCCATAAAGAGGGAGG - Intergenic
1171408979 20:24933533-24933555 CAGAGCCCCCACTGGGAGGGAGG - Intergenic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1174175261 20:48640577-48640599 CAGTTGCCACCAAGAGAGGGTGG - Intronic
1174303092 20:49596154-49596176 CTGTGCCCACAAAGAGGGGTGGG + Intergenic
1175274346 20:57757655-57757677 CACTGTCCCCTGAGAGAGGGAGG + Intergenic
1175760937 20:61561956-61561978 CAGGGCTCCCAGAGAGAGAGAGG + Intronic
1175761012 20:61562192-61562214 CAGGGCTCCCAGAGAGAGAGAGG + Intronic
1176235102 20:64050280-64050302 CGGAGCCCACAAAGAGAAGGGGG + Intronic
1178313205 21:31546942-31546964 CTGTGCCCCAAAATAGTGGGGGG + Intronic
1179379088 21:40881698-40881720 CAAGGCCCCCAGGGAGAGGGTGG - Intergenic
1179569352 21:42268978-42269000 CTGTGCCCAGAAAGAGAGGTGGG + Intronic
1179647334 21:42783997-42784019 CAGAGACCCGGAAGAGAGGGGGG - Intergenic
1180655018 22:17413036-17413058 ATGTGCGCCCCAAGAGAGGGTGG - Intronic
1181376186 22:22460063-22460085 CAGCTCCCCCATACAGAGGGAGG + Intergenic
1183073572 22:35412610-35412632 CTGTGCCCCCAAAGATGGAGGGG - Exonic
1183539162 22:38419601-38419623 CAGTGCCCACAGTGAGAAGGAGG - Intergenic
1184003005 22:41688944-41688966 CAGTGCCCCCGTAGAGGGCGGGG - Intronic
1184747674 22:46465473-46465495 CAGTCCCCAGAATGAGAGGGAGG - Intronic
1185419815 22:50728998-50729020 CTGTGCCCCCAAACAGAAAGGGG - Intergenic
949128545 3:474187-474209 CAGTGCCCCCAAATAATTGGAGG + Intergenic
950410624 3:12834082-12834104 CAGGGCCCCCAGTGAGATGGTGG - Exonic
953410687 3:42688944-42688966 CAGTGGCCCCAAAGAGTGAGCGG - Exonic
953711493 3:45274933-45274955 AGGTGCCCCTAAAGAGAAGGGGG - Intergenic
953878636 3:46680369-46680391 CAGTGCCCCCAGCGGGAGTGGGG + Intronic
954422025 3:50423863-50423885 CAAGGCCCCCAAAGAGGGGAAGG + Intronic
954580310 3:51699654-51699676 CAGTGCCAACCCAGAGAGGGAGG - Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
955356639 3:58237674-58237696 CGGAGCCCCCAAACAGAGCGCGG + Exonic
955687787 3:61562945-61562967 CCCAGCCCCCAGAGAGAGGGAGG - Intronic
958712381 3:97732996-97733018 CACTGTCCCCACAGAGAGGCCGG + Intronic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
962440901 3:135415279-135415301 CAGTCCCCCAAAGCAGAGGGAGG + Intergenic
965016653 3:163167444-163167466 CAGTGCACCCAAAGTGGTGGTGG - Intergenic
968377049 4:52389-52411 CAGTGCCCCTAGAGAGAGCAGGG - Intergenic
968402036 4:306291-306313 CAGTGCCCCTAGAGAGAGCAGGG + Intergenic
968421608 4:489544-489566 CAGTGCCCCTAGAGAGAGCAGGG - Intronic
968734700 4:2289429-2289451 CAGCCTCCCCAAAGTGAGGGGGG + Intronic
969056911 4:4407918-4407940 AGGGGCCCCCAAAGAGAAGGAGG + Intronic
969162610 4:5274691-5274713 CAGAGCTCCCAAAAAAAGGGAGG - Intronic
969538739 4:7772741-7772763 CAGTGCACCCAGAGAGAATGTGG - Intronic
969608748 4:8215647-8215669 CACTGCCCCAGACGAGAGGGGGG + Intronic
970243704 4:14036056-14036078 CAGTGTCCAGAAAGAGAAGGTGG - Intergenic
971717336 4:30195825-30195847 TAGCTCCCCCAAAGAAAGGGTGG - Intergenic
972342646 4:38165850-38165872 CAGTGTGCCCAAAGAGATGCTGG - Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
976318735 4:83687121-83687143 AAGTTTCCCAAAAGAGAGGGAGG - Intergenic
977287540 4:95127704-95127726 CAGGGCTCCTAAAGAGAGGACGG + Intronic
980564816 4:134525929-134525951 CACTGCCCCCAAAGACATTGAGG - Intergenic
981317670 4:143356667-143356689 CAGTTCACACAAAGAAAGGGAGG + Intronic
982406626 4:155027513-155027535 CAGAGTGGCCAAAGAGAGGGTGG - Intergenic
986605827 5:9521942-9521964 CTGGACCCCTAAAGAGAGGGAGG - Intronic
988885063 5:35547735-35547757 CAGTGCCCACACAGAGAAGAGGG - Intergenic
991603983 5:68381916-68381938 GAGTGCCCCCAAAGACAGAGAGG + Intergenic
992340364 5:75816988-75817010 CTTTGCCCTAAAAGAGAGGGAGG + Intergenic
993977099 5:94496100-94496122 CAGTCCCCTCAAAGAGAGGTTGG + Intronic
994354816 5:98783162-98783184 AGGTTCCTCCAAAGAGAGGGAGG - Intronic
999765948 5:154740975-154740997 CAGTGCCCCTGAGGAGAGGATGG - Intronic
1001453885 5:171846327-171846349 CAGTGCTACCTAGGAGAGGGAGG + Intergenic
1001516448 5:172358566-172358588 CAAAGGCCCCTAAGAGAGGGCGG + Intronic
1001940443 5:175736215-175736237 CAGGGCCCCCAAAGCCAGAGTGG + Intergenic
1003027349 6:2567189-2567211 CACTGCCCTCAAGGAGAGAGAGG - Intergenic
1003863023 6:10339097-10339119 CAGTGTCATCAAAGAGAGGGAGG - Intergenic
1005755757 6:28923825-28923847 CTGTGCCCCCTAAGCGAGAGCGG + Exonic
1010042790 6:71406355-71406377 CTAAGCCCCCAAAGAGATGGAGG - Intergenic
1012862069 6:104572038-104572060 GAGTGCCCCAAAAGAGAGCTAGG + Intergenic
1013656554 6:112252894-112252916 CATTGCCCCAAAAAAGAGAGTGG - Intronic
1014209908 6:118697490-118697512 CAGTCCCACCAAAGTGAAGGTGG - Intronic
1016348726 6:143144465-143144487 AAGTATCCCCAAAGAGAGAGGGG + Intronic
1016848232 6:148590556-148590578 AAGGGCCACCAAAGTGAGGGGGG + Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017506365 6:155072363-155072385 CAGTGCAGCAAAGGAGAGGGAGG + Intronic
1018455502 6:163948485-163948507 TAGAGCCCCGAGAGAGAGGGAGG + Intergenic
1019608238 7:1920993-1921015 CAGGCAACCCAAAGAGAGGGTGG + Intronic
1025924755 7:65948512-65948534 GATTTGCCCCAAAGAGAGGGAGG - Intronic
1025932113 7:66003869-66003891 GATTTGCCCCAAAGAGAGGGAGG - Intergenic
1026359619 7:69591521-69591543 CAGTCCCTCCAAACAGAGTGGGG - Intergenic
1026470791 7:70693248-70693270 CAGTGCCCCCAGAGGGTGTGGGG - Intronic
1027113004 7:75455675-75455697 CGGGGACCCCAAAGGGAGGGTGG - Intronic
1027285251 7:76640286-76640308 CGGGGACCCCAAAGGGAGGGTGG - Intergenic
1027348261 7:77284257-77284279 CAGTGCCCCCAAGAAGAGTATGG - Intronic
1028128867 7:87147132-87147154 CAGAGCCCCCCAAGGGCGGGGGG + Intergenic
1030673022 7:112357597-112357619 CAGTGCTCCCAAATGTAGGGTGG + Intergenic
1031925674 7:127636078-127636100 CCGAGCCTCCAAAGAGAGGGAGG - Intergenic
1033171241 7:139086404-139086426 CAGTACCCACAATTAGAGGGTGG - Intronic
1034557761 7:151860769-151860791 CAGTGCCCTCTAGGAGAGGTAGG - Intronic
1035839147 8:2792035-2792057 CAGTGCCGCCAAATACAGGGTGG - Intergenic
1037646395 8:20796353-20796375 CAGTGCCCCGGAATAGAGGAGGG + Intergenic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1041695746 8:60734392-60734414 CAGTCGCCAGAAAGAGAGGGAGG + Intronic
1042364772 8:67923580-67923602 CAGAGCCCCCATACAAAGGGAGG - Intergenic
1048412141 8:134186139-134186161 CATATCCCCCAAGGAGAGGGAGG - Intergenic
1049018780 8:139939830-139939852 CAGGGCCCAGGAAGAGAGGGAGG + Intronic
1049583076 8:143421495-143421517 CAGGGCCCCAGTAGAGAGGGTGG + Intronic
1053786177 9:41654446-41654468 CAGTGCCAGCGAAGAGAGGTGGG + Intergenic
1053786310 9:41655159-41655181 CTGTTCCCGCAAAGAGTGGGGGG - Intergenic
1054158872 9:61659752-61659774 CAGTGCCAGCGAAGAGAGGTGGG - Exonic
1054175023 9:61869103-61869125 CTGTTCCCGCAAAGAGTGGGGGG - Intergenic
1054449751 9:65397439-65397461 CAGTGCCAGCGAAGAGAGGTGGG + Intergenic
1054478646 9:65590757-65590779 CAGTGCCAGCGAAGAGAGGTGGG - Intergenic
1054662514 9:67711690-67711712 CTGTTCCCGCAAAGAGTGGGGGG + Intergenic
1055594107 9:77848122-77848144 CAGTGGCCCCAAGGAGACAGGGG - Intronic
1057505313 9:95628488-95628510 CTCTGCCCCCAGAGAGAGCGAGG + Intergenic
1058991481 9:110257935-110257957 CAATGTTCCCAAAGAGAGGGAGG + Intergenic
1060376621 9:123120341-123120363 CAGTGCCTCCTGAGAGAGGGTGG - Intronic
1061630535 9:131869536-131869558 TAATGCTCCCAAGGAGAGGGAGG + Intronic
1062633310 9:137477116-137477138 CGCTGCCCCCAAAGGAAGGGAGG - Intronic
1203572188 Un_KI270744v1:141857-141879 CAGTGCCCCTAGAGAGAGCAGGG + Intergenic
1185520415 X:734481-734503 CAGGGTCCCCAGAGAGAGTGGGG + Intergenic
1185540427 X:898974-898996 CAGTTCCCTCAAAGAGCAGGGGG - Intergenic
1185643495 X:1600985-1601007 CGGTGCCCCCAAGGAGAGCCCGG + Exonic
1186302769 X:8218554-8218576 CAGTGCACCCTGAGAGAGAGAGG - Intergenic
1194010294 X:88553575-88553597 CACTGCCCCCAAATTGAGGAGGG - Intergenic
1197301977 X:124792033-124792055 CAGTCCTCCCAAAGATAGGTCGG - Intronic
1197436858 X:126439850-126439872 CAGTGAAGCCAAACAGAGGGAGG - Intergenic
1197692823 X:129522355-129522377 CAGCGCCCACTAGGAGAGGGAGG + Intronic
1200071684 X:153532357-153532379 CAGAGCCCCCAAAGCCAGGGAGG + Intronic
1200111694 X:153743913-153743935 CAGCGCCCCCAGGGAGTGGGAGG - Exonic