ID: 1091284011

View in Genome Browser
Species Human (GRCh38)
Location 11:134397965-134397987
Sequence CAGTCTGACCACAGCGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 131}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091284001_1091284011 22 Left 1091284001 11:134397920-134397942 CCCCTTGCCCAGCACTCTCTTGA 0: 1
1: 0
2: 0
3: 12
4: 258
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091284005_1091284011 15 Left 1091284005 11:134397927-134397949 CCCAGCACTCTCTTGAGGCTGAT 0: 1
1: 0
2: 0
3: 11
4: 208
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091284000_1091284011 23 Left 1091284000 11:134397919-134397941 CCCCCTTGCCCAGCACTCTCTTG 0: 1
1: 0
2: 8
3: 70
4: 833
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091283997_1091284011 28 Left 1091283997 11:134397914-134397936 CCCCTCCCCCTTGCCCAGCACTC 0: 1
1: 0
2: 7
3: 81
4: 822
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091284002_1091284011 21 Left 1091284002 11:134397921-134397943 CCCTTGCCCAGCACTCTCTTGAG 0: 1
1: 0
2: 2
3: 15
4: 218
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091284003_1091284011 20 Left 1091284003 11:134397922-134397944 CCTTGCCCAGCACTCTCTTGAGG 0: 1
1: 0
2: 3
3: 41
4: 295
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091283999_1091284011 26 Left 1091283999 11:134397916-134397938 CCTCCCCCTTGCCCAGCACTCTC 0: 1
1: 0
2: 8
3: 69
4: 757
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091284006_1091284011 14 Left 1091284006 11:134397928-134397950 CCAGCACTCTCTTGAGGCTGATG 0: 1
1: 0
2: 0
3: 9
4: 209
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131
1091283998_1091284011 27 Left 1091283998 11:134397915-134397937 CCCTCCCCCTTGCCCAGCACTCT 0: 1
1: 1
2: 2
3: 55
4: 644
Right 1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG 0: 1
1: 0
2: 1
3: 3
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091284011 Original CRISPR CAGTCTGACCACAGCGACTC AGG Intronic
901465498 1:9418415-9418437 GGGTGTGACCACAGTGACTCCGG + Intergenic
902268710 1:15287773-15287795 CAGTCTGTCTACAGCTGCTCAGG - Intronic
902320086 1:15656120-15656142 CAAGCTGAACACAGTGACTCTGG - Intronic
905622046 1:39456795-39456817 CAGCCAGACCACAGGGACTTGGG - Intronic
906061844 1:42953950-42953972 CAGTCTCACCACATCCACTGGGG + Intronic
911190040 1:94939272-94939294 CAGTCAGACCACAGCATTTCTGG - Intergenic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
912760277 1:112360192-112360214 TACTCTGACCACAGGGACACTGG - Intergenic
919785278 1:201254690-201254712 CAGGCTGACCCCAGGGACTTGGG - Intergenic
920511443 1:206555339-206555361 CAGTGTGGCCACAGAGAATCTGG + Intronic
922605894 1:226889794-226889816 CAGCCTGGCCACCGCGTCTCGGG + Intronic
923292657 1:232561697-232561719 CAGGCTGTCCAGAGTGACTCTGG + Intergenic
923806803 1:237266503-237266525 CTGTCAGACCACAGTGATTCTGG + Intronic
1073331861 10:102675236-102675258 AGGTCTGTCCACAGCAACTCTGG + Exonic
1076014414 10:127015914-127015936 CTGTCTTACCACAGCGTCTGGGG + Intronic
1077095621 11:797861-797883 CCGCCTGGCCACCGCGACTCCGG + Exonic
1078988095 11:16613976-16613998 CCGTCTGCCCTCAGAGACTCGGG + Intronic
1079387487 11:19993669-19993691 CAGTCTGATCACATGGCCTCTGG + Intronic
1088760443 11:112924358-112924380 CATTCTGACCATGGAGACTCAGG + Intergenic
1090976463 11:131684267-131684289 CAACCTGACCACAGCGATCCAGG + Intronic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1093342788 12:17998706-17998728 CAGGCTGACCTCAGTGACACAGG + Intergenic
1098842839 12:75497130-75497152 CAGTTTGACCACTGTGACTTTGG + Exonic
1101246036 12:102885316-102885338 GAGACTGACCCCAGCGACCCAGG + Intronic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1109366621 13:61364632-61364654 CAGTCTGGCTACAGGGGCTCTGG - Intergenic
1115511299 14:34140058-34140080 CAGTCTGGCTACAGCGGCTTTGG - Intronic
1118070319 14:62239592-62239614 CATTCTGACCACAGAAGCTCTGG + Intergenic
1132405768 15:101541215-101541237 CTGTCTGTCCACAGAGACCCTGG - Intergenic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1139415751 16:66807927-66807949 CAGTCTCACCACAGTCACCCAGG + Intronic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1141147992 16:81545216-81545238 CAGGCTGACCACAGGTACTGTGG + Intronic
1145025439 17:19464809-19464831 CTCTCTGACGTCAGCGACTCAGG + Intergenic
1147583837 17:41641346-41641368 CAGTCTGACCTCTGCTTCTCTGG - Intergenic
1155958496 18:31974243-31974265 CAGTCTGACCCCAGCCAATGGGG - Intergenic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1157175703 18:45450015-45450037 CAGTCTGACCATAGTGAGACAGG - Intronic
1157695085 18:49716180-49716202 CAGTCTGGCCACAGCGGCCTTGG + Intergenic
1158986511 18:62823282-62823304 AAGTCTGGGCACAGCGACTCAGG + Intronic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1163909979 19:20180718-20180740 CAGCCTGACCACAGTGGCTGGGG - Intronic
1167751728 19:51384760-51384782 CAGGCTGGTCACAGCGGCTCAGG + Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927857297 2:26535650-26535672 CAGTCTCTCCACACTGACTCTGG + Intronic
927911151 2:26900874-26900896 CAGTCTGCCCACCGCGAGGCTGG - Intronic
928309547 2:30197980-30198002 CAGCCTGCCCAAAGCCACTCTGG - Intergenic
932463610 2:71898854-71898876 CAGTCTGACACCAGCCCCTCGGG - Intergenic
935299231 2:101679203-101679225 CAGCCTGACCACAGTTACTTTGG + Intergenic
948798433 2:240419053-240419075 AACTCTGACCACAGAGGCTCAGG + Intergenic
1170912755 20:20591185-20591207 GAATCTGAGCACAGCGGCTCGGG + Exonic
1173914411 20:46696270-46696292 CAGTCTGACCATAGCAAGCCTGG - Intergenic
1174545413 20:51321545-51321567 CAGTCTGACCACAGACACCACGG - Intergenic
1174545757 20:51323956-51323978 CAGACTGACTCCAGCGATTCAGG + Intergenic
1175217702 20:57400235-57400257 GACTCTGTCCACAGAGACTCAGG - Intronic
1176084064 20:63287976-63287998 CAGTGTGAGGACAGCGTCTCGGG + Exonic
1177735512 21:25084159-25084181 CCATCTGACCACAGGGACTATGG - Intergenic
1179584193 21:42364690-42364712 CAGTCTGGCCACACTGGCTCAGG + Intronic
1180133916 21:45848184-45848206 CAGCCTGACCATCGGGACTCAGG + Intronic
1181014648 22:20062112-20062134 CGGTCTGTCCCCAGCGACCCTGG + Intronic
1181925865 22:26358043-26358065 CAGTCTGGCCACAGCACCTGTGG - Intronic
1183027124 22:35073650-35073672 CAGACCGACCACAGCTTCTCTGG - Intronic
1184995909 22:48207477-48207499 CAGGATGACCACAGAGACCCAGG - Intergenic
1185295618 22:50052294-50052316 CAGTTTGACCACAGCTAAGCAGG - Intronic
1185394397 22:50579321-50579343 CAGGCTGCCCACAGCCACCCGGG + Intronic
949774986 3:7622806-7622828 CAGTCTGCCCTCATGGACTCTGG - Intronic
952307946 3:32161977-32161999 CATTCTGACCACCACTACTCCGG + Intronic
953026368 3:39147535-39147557 CTGTGTGACCACAGCCACTAAGG + Intronic
953407496 3:42666674-42666696 CAGCCTGGCCACGGCCACTCAGG - Intergenic
956170222 3:66427516-66427538 CAGGCTGGGCACAGTGACTCTGG + Intronic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
961305978 3:125959312-125959334 CAGGCTGGCCACAGTGACACGGG - Intergenic
962426568 3:135273825-135273847 CTGTTTGTCCACAGCCACTCTGG + Intergenic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
967037201 3:185656792-185656814 CAGCCTGAGCATAGCAACTCAGG - Intronic
967880276 3:194296988-194297010 CGCTCTGCCCACTGCGACTCCGG + Intergenic
968982723 4:3859270-3859292 CAGTCTAAACACTGCGGCTCAGG + Intergenic
970159233 4:13172363-13172385 CAGGCAAACCACAGTGACTCCGG + Intergenic
971253312 4:24991416-24991438 CAGTCTGACCACATCCACTCTGG - Intergenic
972405330 4:38740847-38740869 GTGTCTGACCAAAGTGACTCAGG + Intergenic
976547169 4:86349951-86349973 CAGTCTCATCACATCTACTCAGG - Intronic
979277150 4:118827204-118827226 CAGTCTGACCCCAGCCAACCTGG - Intronic
979538963 4:121857398-121857420 CAGGCTGGGCACAGCGGCTCAGG - Intronic
984653081 4:182290116-182290138 CAGTTAGTCCACAGCGACACAGG - Intronic
985652149 5:1112196-1112218 CTGTCTGACCGCCGCGACCCGGG + Intergenic
987818006 5:22929164-22929186 CAGTCTGACCCCAGCCAATGGGG + Intergenic
990748544 5:58986092-58986114 CTGTGTGACCACAGCGACATAGG - Intronic
994131201 5:96230156-96230178 CAGTATGAGCACAGAGACTTAGG + Intergenic
995018222 5:107337354-107337376 CAGGCTGACCTCAGTGTCTCTGG - Intergenic
997353822 5:133249517-133249539 CAGTGTGACCACAGTGACCGTGG - Exonic
1001576287 5:172766227-172766249 GGGTCTGAACACAGTGACTCCGG + Intergenic
1001597001 5:172904904-172904926 CAGCCTGGCCAGAGCGCCTCAGG + Intronic
1002562563 5:180092226-180092248 CAGTCTGAGCACACCGAGTCAGG - Intergenic
1002626718 5:180534651-180534673 CTCTCGGACCCCAGCGACTCCGG - Intronic
1002626801 5:180534896-180534918 CTCTCGGACCCCAGCGACTCCGG - Intronic
1003223739 6:4186510-4186532 GAGTCTGAGCACAGCTTCTCTGG + Intergenic
1004028009 6:11837612-11837634 CAGTCTGGCTACAGTGACTTTGG - Intergenic
1004621609 6:17335543-17335565 CAGTCTGGGCACAGTGGCTCAGG - Intergenic
1009959490 6:70501219-70501241 CAGTCTGGCCACAGCTGCTTTGG + Intronic
1016671718 6:146716959-146716981 CAGCCAGACCACAGCAACACAGG + Exonic
1016990488 6:149924942-149924964 CATTCTGCCCCCAGCCACTCAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018420138 6:163633987-163634009 CAGACTGATCACAGCTACGCAGG - Intergenic
1018587376 6:165376631-165376653 CAGGCTGGGCACAGCGGCTCTGG + Intronic
1021503757 7:21357963-21357985 CAGGCTGACCACATCAACTGAGG - Intergenic
1024629002 7:51231929-51231951 AAGTCTAACCACAGCCACCCAGG + Intronic
1028991279 7:97051330-97051352 CAGTCTGTCTACAGCGGCTTTGG - Intergenic
1031527892 7:122843666-122843688 CAGTCTGACAAGAGAGACTGGGG + Intronic
1033876649 7:145827626-145827648 AATCCTGACCACAGCTACTCGGG - Intergenic
1034894108 7:154864397-154864419 CAGTGAGACCGCAGAGACTCAGG - Intronic
1036668941 8:10766988-10767010 AACTCTGCCCACAGAGACTCTGG + Intronic
1038328431 8:26589634-26589656 AGATCTGACCACAGGGACTCAGG - Intronic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1051440161 9:17074951-17074973 CAGGCTGGCCACAGTGGCTCAGG + Intergenic
1052085755 9:24263673-24263695 CAGTTTTACCACAGAAACTCAGG - Intergenic
1052168625 9:25365244-25365266 CAGGCTGACCAAATAGACTCTGG - Intergenic
1056993198 9:91429881-91429903 CAGCTTGCCCACAGCCACTCAGG + Intergenic
1058152895 9:101481404-101481426 CAGTCAGTCCACAGTGTCTCTGG - Intronic
1059519745 9:114930165-114930187 CTATTTGACCACAGCCACTCTGG - Exonic
1060508167 9:124214008-124214030 CAGTCTGACCTCAGAGCCTCTGG - Intergenic
1061260546 9:129478528-129478550 TAGTCTCACCACGGCTACTCAGG + Intergenic
1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG + Intronic
1186163835 X:6805797-6805819 CAGACTGGGCACAGTGACTCAGG - Intergenic
1188222679 X:27559688-27559710 CAGTCTGACCTCAACTAGTCAGG + Intergenic
1189468788 X:41298342-41298364 CTGTATGCCCACAGAGACTCTGG + Intergenic
1189905664 X:45756649-45756671 CAATCTGAACACAGCAACTTTGG + Intergenic
1190043666 X:47094020-47094042 CAGTCTCAGCCCAGCTACTCGGG - Intergenic
1193895519 X:87110309-87110331 CAGGCTCTCCACAGCCACTCAGG + Intergenic
1194838848 X:98714556-98714578 CAGGCTGCCCACGGCTACTCTGG + Intergenic
1197698342 X:129575347-129575369 CAGTCTGACTCCAGCGACATGGG - Intronic
1199505198 X:148553633-148553655 CCTTCTGACCACAGGGATTCAGG - Intronic
1199664622 X:150086963-150086985 CAGCATGGCCACAGCTACTCTGG + Intergenic
1199996157 X:153028112-153028134 CAGTGTGCCCTCAGCCACTCTGG - Intergenic
1200788512 Y:7279527-7279549 CAGTCTGACCCCAGCCAATGGGG - Intergenic
1201406363 Y:13654008-13654030 CTGGCTGACCTCAGCGACTGAGG - Intergenic
1201966194 Y:19739050-19739072 AGGTGTGACCACAGAGACTCAGG - Intronic