ID: 1091285201

View in Genome Browser
Species Human (GRCh38)
Location 11:134405041-134405063
Sequence CTGTGGATGAGGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 941
Summary {0: 1, 1: 0, 2: 7, 3: 96, 4: 837}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091285191_1091285201 8 Left 1091285191 11:134405010-134405032 CCACGAGCGGCCGTCTCTCCCAC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285188_1091285201 15 Left 1091285188 11:134405003-134405025 CCCCGTGCCACGAGCGGCCGTCT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285195_1091285201 -10 Left 1091285195 11:134405028-134405050 CCCACTCTGTGGTCTGTGGATGA 0: 1
1: 0
2: 1
3: 35
4: 201
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285190_1091285201 13 Left 1091285190 11:134405005-134405027 CCGTGCCACGAGCGGCCGTCTCT 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285193_1091285201 -2 Left 1091285193 11:134405020-134405042 CCGTCTCTCCCACTCTGTGGTCT 0: 1
1: 0
2: 6
3: 66
4: 543
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285187_1091285201 18 Left 1091285187 11:134405000-134405022 CCTCCCCGTGCCACGAGCGGCCG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837
1091285189_1091285201 14 Left 1091285189 11:134405004-134405026 CCCGTGCCACGAGCGGCCGTCTC 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG 0: 1
1: 0
2: 7
3: 96
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091285201 Original CRISPR CTGTGGATGAGGGAAGAGGA GGG Intronic
900126376 1:1070648-1070670 CAGAGGATGGGGGAAGAGAAAGG + Intergenic
900140132 1:1136384-1136406 GTGTGGTCGAGGGAAGGGGAAGG + Intergenic
900894967 1:5476999-5477021 TTGTGGAAGATGGAAGAGCAAGG + Intergenic
900946852 1:5835674-5835696 CAGTGGTTGAGGCAGGAGGATGG - Intergenic
901210188 1:7520241-7520263 AGGAGGAGGAGGGAAGAGGAGGG - Intronic
901456782 1:9367693-9367715 CGGAGGATGAGGGAAGACCAGGG - Exonic
901684200 1:10934697-10934719 CTGTAGTTGGGGGAAGAGAAGGG - Intergenic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
901857297 1:12052683-12052705 CTGTGGGAGAGGGAAGGGGCCGG - Intergenic
902165416 1:14567209-14567231 CTGTGGCTCAGGGAATAGGGAGG + Intergenic
902513901 1:16979975-16979997 CTGTGGAAGAGGCCAGAGGTGGG - Intronic
903261974 1:22136398-22136420 CTGGGGTTGGGGAAAGAGGAGGG + Intronic
903328613 1:22585695-22585717 CTGTGGGTGAGAGATGAGGTAGG + Intronic
903597825 1:24509507-24509529 CTGTGAATGAGCAAAGAGGGTGG - Intronic
904271975 1:29356109-29356131 CTGTGGAAGTAGGAAGAGAAGGG - Intergenic
904353498 1:29924049-29924071 TTGTGGAGGAGGGGAGAGGAAGG - Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904488750 1:30845085-30845107 ACGTGGCTGGGGGAAGAGGAAGG - Intergenic
904490408 1:30855356-30855378 CTGTGCAGGAGGGAAGAGTGCGG - Intergenic
904641856 1:31937648-31937670 ATGTGGGTGAGGGCAGGGGAGGG - Intronic
904704692 1:32380976-32380998 CTGAGGATGAGGGATGAGAGGGG + Intronic
904727186 1:32558129-32558151 CAGAGGATGGGGGAAAAGGAGGG + Intronic
905174045 1:36125263-36125285 CCGTGGCTGTGGAAAGAGGAGGG - Intergenic
905340694 1:37275383-37275405 CTGTGGCTGCAGGGAGAGGATGG - Intergenic
905398332 1:37682873-37682895 CTGAGGCTCAGGGAAGTGGATGG - Exonic
906141156 1:43534345-43534367 CTGTGGCTATGGGAAAAGGATGG + Intronic
906258862 1:44371003-44371025 CTTATGATCAGGGAAGAGGAGGG + Intergenic
906316594 1:44790325-44790347 CTGGTGATGAGGGTAGAGGTGGG - Intergenic
906319669 1:44808294-44808316 CTGTGGAGGAGGGAAGGGTTAGG + Intergenic
906538083 1:46563028-46563050 CTCTGGATGATGGAAAATGATGG - Intronic
906559368 1:46744711-46744733 CTGTGGCTGAGGGAAGCCCATGG - Intergenic
906634336 1:47398413-47398435 CTGTTGATGAGGGAATGGCAAGG - Intergenic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
907086046 1:51675193-51675215 CTGTAAATGAGTGAAGAGTATGG + Intronic
907275257 1:53313429-53313451 CTGTGGAGGACGGTGGAGGAAGG - Intronic
907358083 1:53892806-53892828 CTCTGGCTGAGGTGAGAGGATGG + Intronic
908460674 1:64345890-64345912 CTTGGGATCAGGGAAAAGGAGGG - Intergenic
908629684 1:66088762-66088784 TTGGAGATGGGGGAAGAGGAGGG - Intronic
909391315 1:75125251-75125273 CTTTGGATTAGTGATGAGGAAGG + Intergenic
910151529 1:84153068-84153090 CTGTGTCTTAGGGAATAGGAAGG + Intronic
911064229 1:93773434-93773456 CTGTGCAGGTGGGAAGGGGAGGG + Intronic
911163017 1:94700506-94700528 CTGAAGATTAGGGTAGAGGAGGG - Intergenic
911179517 1:94848494-94848516 CTAAGGAGGTGGGAAGAGGAGGG - Intronic
911667913 1:100575158-100575180 CTGTGGATGGGGGTAGAGGGTGG + Intergenic
912489674 1:110055138-110055160 CTGTGGCTGAGAGAAAAGCAAGG + Intronic
912512846 1:110200233-110200255 CTGTGGAAGAGGGATGAGTAAGG - Exonic
912938460 1:114024122-114024144 CTGTGGACCAGGGAAGAAGTTGG + Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913316304 1:117556068-117556090 CTGAGGTTGAGGAAAAAGGAAGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
914974361 1:152346542-152346564 CTTTGGATGAGGGAAATTGAAGG - Intergenic
915334101 1:155130457-155130479 CTTGGGAGGAGGGGAGAGGAGGG + Intronic
915366584 1:155320329-155320351 ATGTGAATGAGGGGAGTGGAGGG + Intronic
915597921 1:156905903-156905925 CAGTGGCTGAGGGAAGTGGGAGG - Intronic
915752895 1:158228468-158228490 CTGTGCTTGAGGAAAGGGGAGGG + Intergenic
916001732 1:160623108-160623130 GTGTGGTTGAGGAAAGAGTATGG + Intronic
916415528 1:164588981-164589003 CTGGGGAGGAGGGGAGAGGCCGG - Intronic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
916790802 1:168123351-168123373 AGGAGGTTGAGGGAAGAGGATGG + Intronic
916997018 1:170312090-170312112 CTGAGTATGAGGGCAGAGAAAGG + Intergenic
917057232 1:170996339-170996361 CTGTTAATCAGGGAAGATGAAGG + Intronic
917680880 1:177366146-177366168 CTGTGGATTAGGCAAAATGAAGG - Intergenic
917744741 1:177996466-177996488 GGGTGGCTGAGGGAGGAGGAAGG + Intergenic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919806504 1:201383830-201383852 CTGTGGGGGAGGGAAGGGGAGGG - Intronic
920241830 1:204557958-204557980 CACTAGATGAGGAAAGAGGAAGG + Exonic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920442921 1:205993389-205993411 ATGTTGAAGAGGGAAAAGGAGGG + Intronic
920769441 1:208867134-208867156 CTTTGGATGAGGGAAGTCTAAGG + Intergenic
921621872 1:217334301-217334323 CAGTGTATGAGGGGAGAGGAAGG - Intergenic
922229314 1:223671951-223671973 CTGGGGATGAGTGTGGAGGAAGG + Intergenic
922343271 1:224674604-224674626 CTGTGGTTGGGGGAACAGGGAGG + Intronic
922429048 1:225528906-225528928 GTGGGGATGAGGGAAGGAGAGGG - Intronic
922640196 1:227222392-227222414 GTGTGGCTGAGGCATGAGGAAGG + Intronic
922741650 1:228017385-228017407 CGCAGGAGGAGGGAAGAGGAGGG + Intronic
923044474 1:230345434-230345456 CTGCAGATGAGGGGAGAGGAGGG + Intronic
923271444 1:232358721-232358743 CTGTGGTTAAGGGCAGTGGAGGG + Intergenic
923300054 1:232631877-232631899 GGGTGGCTGAGGCAAGAGGATGG + Intergenic
923402863 1:233632037-233632059 ACGTGGAAGAGGGAACAGGATGG - Intronic
923940741 1:238822895-238822917 CAGGGGTTGAGGGAAGGGGAAGG + Intergenic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924829910 1:247582470-247582492 GTGTGGTTGAGACAAGAGGAAGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063535477 10:6878366-6878388 CCATTGATGAGGGAAGAGCAGGG - Intergenic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064501208 10:15975630-15975652 CTGTGAATGAGGGCAGCCGATGG + Intergenic
1064674897 10:17750665-17750687 TTGGGGTTGTGGGAAGAGGATGG - Intergenic
1065001068 10:21337905-21337927 CTGTGGATTTGAGAAAAGGAAGG - Intergenic
1065542075 10:26780617-26780639 CTGAGGTTGAGGGATGAGGGAGG - Intronic
1065650948 10:27890594-27890616 CTGTGGAGTAGGGAATGGGAGGG + Intronic
1065889486 10:30109068-30109090 CTGAGGACGAGGGAAGATGCTGG - Intronic
1066351711 10:34642367-34642389 GGGTGGATCAAGGAAGAGGAGGG - Intronic
1067558086 10:47286085-47286107 CTGGGGATGAGGGGAAAAGAGGG + Intergenic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1068640975 10:59407296-59407318 TTGGGTATGAGGGAAGAGCAGGG - Intergenic
1068738605 10:60443207-60443229 CTATAGGTGAGGAAAGAGGAAGG + Intronic
1069189839 10:65473306-65473328 CTCTGGATGAGGGAGAAGGAAGG - Intergenic
1069293629 10:66815314-66815336 CTGGGGATGAAGGGAGGGGATGG - Intronic
1069746145 10:70716258-70716280 CTGTGAATGTGGGAACAGAAAGG + Intronic
1070534515 10:77365500-77365522 CTTTGGTTGGGGGCAGAGGAGGG + Intronic
1070536608 10:77383144-77383166 CTCTGAATGAGGGAGGGGGATGG - Intronic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1070870254 10:79745055-79745077 TTGTGGTTGAGATAAGAGGAAGG + Intergenic
1070950714 10:80428677-80428699 AAGTGGATGAGGGAAGGGTATGG + Intronic
1071409252 10:85372386-85372408 ATGTGGATGGGGGAAGTTGAGGG + Intergenic
1071637174 10:87267275-87267297 TTGTGGTTGAGATAAGAGGAAGG + Intergenic
1071658071 10:87470679-87470701 TTGTGGTTGAGATAAGAGGAAGG - Intergenic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1072185680 10:93036258-93036280 CTGTGAAAGACTGAAGAGGAGGG - Intronic
1072417198 10:95259033-95259055 AGGAGGATGAGGGAAAAGGAGGG + Intronic
1072667927 10:97407879-97407901 CTGAGGCTCAGGGAAGAGTAAGG - Intronic
1072690720 10:97570896-97570918 CAGGGGATGGGGGCAGAGGAGGG - Exonic
1072875030 10:99163417-99163439 CTGAGGAGGTGGAAAGAGGAAGG - Intronic
1073073129 10:100807383-100807405 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073073141 10:100807434-100807456 CTGTGGGTGAGGGAACAGGTGGG - Intronic
1073073164 10:100807536-100807558 CTGTGGGTGAGGGAGCAGGTGGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074180616 10:111059696-111059718 TGGTGGATGAGGGATGTGGAGGG - Intergenic
1074270463 10:111948669-111948691 CTGAGGATGAGGGAAGGGGCAGG + Intergenic
1074402559 10:113153916-113153938 ATGTAGATGAGGGAACAGGGAGG + Intronic
1074427873 10:113368215-113368237 TTAAGGATGAGGGAAGGGGAGGG + Intergenic
1075094336 10:119461076-119461098 GTGTGGAGGAGGTAAGAGGTGGG - Intergenic
1075514766 10:123100151-123100173 CTCTGGCTGTGGGAAGAGAAGGG - Intergenic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076550980 10:131278039-131278061 CTGTGGGAGATGGAAGCGGAGGG + Intronic
1076856874 10:133120996-133121018 CTGTGGCTCGGGGAATAGGAGGG + Intronic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1078609540 11:12808453-12808475 CTGAGGCTTAGCGAAGAGGAAGG - Intronic
1078934505 11:15939566-15939588 CTAGGGAGGAGGGAAGAGGCTGG + Intergenic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079131066 11:17747299-17747321 CTGGGGATGGAGGAAGAGCAGGG - Intronic
1079139534 11:17798859-17798881 CTGTGGATGAGGAAACAGGCTGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1080223724 11:29936123-29936145 CTTAGGATGATGGAAAAGGAAGG - Intergenic
1080520515 11:33064500-33064522 GTGTGGCTGAGGGAAGGAGAAGG - Intronic
1080695889 11:34602724-34602746 CTGTGTGTCAGGGAAGAGTAGGG + Intergenic
1080748045 11:35126716-35126738 CTGTGGGTGGGGGAAGAAAAAGG + Intergenic
1081694292 11:45098820-45098842 CAGAGGATGTGGGAACAGGAAGG + Intronic
1081886636 11:46503287-46503309 CTGTGTATCAGGGAATAGGAAGG + Intronic
1082795859 11:57377393-57377415 GCGTGGATGAGAGAAAAGGAAGG - Intronic
1083120635 11:60509632-60509654 CTGGGCATGAGGGAGGGGGAGGG - Intergenic
1083309836 11:61778492-61778514 CTGTGGGTGGGGGAATGGGAGGG + Intronic
1083571884 11:63765502-63765524 GGGTGGGTGAGGGAAGGGGAGGG - Intronic
1083883718 11:65560545-65560567 CTCTGGATGGGCGAAGAAGAGGG + Intergenic
1083997328 11:66278769-66278791 CAGAGGACGAGGGCAGAGGAGGG - Intronic
1084447139 11:69210203-69210225 CTGTGTTTGAAGGAAGAAGAGGG - Intergenic
1084468260 11:69339925-69339947 CAGGGCATTAGGGAAGAGGATGG + Intronic
1084545210 11:69811974-69811996 CTGTGGCGTAGGGAAGAGGTGGG + Intronic
1084888277 11:72224315-72224337 CTTGGGTGGAGGGAAGAGGATGG + Intronic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085121983 11:73973275-73973297 TTGAGGCTGAGGGAAGAGGGAGG + Intergenic
1085129551 11:74026394-74026416 CTGAGGAGGTTGGAAGAGGATGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085603433 11:77876149-77876171 TTTTGTATGAGGGATGAGGAAGG + Intronic
1085648798 11:78247902-78247924 GTGTGGATGAGGGAATGAGAGGG - Intronic
1086064451 11:82731903-82731925 CTGTGGCTGAGGGAGGAGGCCGG - Exonic
1086100393 11:83093084-83093106 TTGTGGGGGAGGGAACAGGATGG + Intergenic
1086144962 11:83541610-83541632 GTGGAGATGAGGGAAGAAGAAGG - Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086789985 11:91025010-91025032 CTTTGGATGTCTGAAGAGGAAGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087126385 11:94630366-94630388 CTGAGAAGGAAGGAAGAGGAGGG + Intergenic
1087147250 11:94824606-94824628 CTGGGGATGAGGGAAGATCTGGG - Intronic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1087529041 11:99355558-99355580 CTGTGGATGATGGTGGTGGAGGG + Intronic
1087549545 11:99630925-99630947 CTGAGGATGAGGGATGAGTTAGG - Intronic
1088685545 11:112281698-112281720 CTGTGGCGCAGGGAAGAGGCAGG - Intergenic
1088744794 11:112796350-112796372 CTGGGGTTGAGGGAAGAATATGG - Intergenic
1088816161 11:113422476-113422498 CTTTGGAAGAGGGAAGAAGGAGG + Intronic
1089051390 11:115548978-115549000 CTGTGGACCAGGTAAGAGGGAGG + Intergenic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089164210 11:116462212-116462234 CTGTCGAAGAGGGTAGAGGCAGG + Intergenic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1090941670 11:131392990-131393012 CTGTGGATGAGGGAAGGCCTAGG + Intronic
1091064194 11:132493267-132493289 CTCGGGAAGAGGGAAGAGAAGGG + Intronic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091446472 12:546617-546639 GTGTGGAAGAGAGAAGAGGAGGG - Intronic
1091552277 12:1545484-1545506 CAGAGGCTGAGGCAAGAGGATGG + Intronic
1091630250 12:2154514-2154536 CAGTGGGTCAGGGAAGAGGCTGG + Intronic
1092278001 12:7076802-7076824 CTGAGGATCAGGGAGGAGAAAGG - Intergenic
1092282613 12:7109071-7109093 CAGAGGAGGAGGGAAGAGGACGG - Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092606768 12:10128765-10128787 AAGTGGATGAGGCAAGAGGTAGG - Intronic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093267511 12:17021050-17021072 CTGGGGATGGGGGAATAGAAAGG + Intergenic
1094131452 12:27079807-27079829 CTGTGGTTGAATGAGGAGGATGG + Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1094609168 12:31976783-31976805 CGGAGGAGGAGGGAAGAGAAGGG + Intronic
1095450997 12:42330289-42330311 TTGCGGTTGAGGTAAGAGGAAGG - Intronic
1095721380 12:45405045-45405067 TTCTGGGTGGGGGAAGAGGAAGG - Intronic
1095839358 12:46675443-46675465 TTGGGGATGAGGGAAGTGGAGGG + Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096116113 12:49056259-49056281 CCCTGCTTGAGGGAAGAGGAAGG - Intronic
1096168910 12:49450352-49450374 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1096317725 12:50583272-50583294 ATGTGGTGGAGGGAAGATGAGGG - Intronic
1096479193 12:51926618-51926640 GAGAGGAGGAGGGAAGAGGACGG - Intergenic
1096793163 12:54057827-54057849 ATGTATGTGAGGGAAGAGGAAGG - Intergenic
1097174961 12:57137294-57137316 TGGGGGATGAGGGAAGAGAATGG + Intronic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1097701810 12:62828019-62828041 CAGTGGGTGAGGGAACAGGAAGG + Intronic
1097710762 12:62914536-62914558 CTGTGGGAGAGGGAAGGTGATGG + Intronic
1097904376 12:64905032-64905054 GTGTGCATGCAGGAAGAGGAGGG - Intergenic
1098150443 12:67541027-67541049 CTGTGGCTGAGGGCAGGGTAGGG - Intergenic
1098185379 12:67890820-67890842 GTGAGGATGGGGCAAGAGGAGGG + Intergenic
1098403464 12:70098503-70098525 CTTTGCATGAGGTAAGAGGGAGG + Intergenic
1099064940 12:77964010-77964032 AGGAGGAGGAGGGAAGAGGAGGG - Intronic
1099610040 12:84856999-84857021 CTCTGACTGAGGAAAGAGGAGGG - Intergenic
1100172134 12:91986980-91987002 AGGTGGAAGAGGGTAGAGGAAGG - Intronic
1100404934 12:94264413-94264435 CTCTGGTTCAGGGAAGAAGATGG + Intronic
1100678722 12:96895588-96895610 CTGAGGCTGAGGCAAGAGAATGG + Intergenic
1101651878 12:106684675-106684697 CTGTGGGTGGGGGAGGAGCATGG - Intronic
1101843158 12:108342137-108342159 AGGAGGAGGAGGGAAGAGGAGGG + Intergenic
1101963422 12:109266213-109266235 CTGTGGGGGAGGTGAGAGGAGGG - Intronic
1102207561 12:111100926-111100948 CTGGGGCTGAGGCAAGAGGCTGG - Intronic
1102551656 12:113696010-113696032 CATGGGATGAGGGATGAGGAGGG - Intergenic
1103003998 12:117407457-117407479 CTTGGTATGAGGGCAGAGGAGGG - Intronic
1103061440 12:117861702-117861724 CTTTAGGGGAGGGAAGAGGAAGG + Intronic
1103345679 12:120248550-120248572 CTGGGGAGGAGGGAAGAGAGGGG - Intronic
1104162645 12:126194480-126194502 CTCTGAATAAGAGAAGAGGAGGG + Intergenic
1104178115 12:126352055-126352077 CAGTGGGTCAGGGAAGAGGGAGG + Intergenic
1104202721 12:126607389-126607411 CTGGGGGTGAGGGTTGAGGATGG - Intergenic
1104505665 12:129329855-129329877 CTGAAGATGAGGGGAGAGTATGG + Intronic
1104505992 12:129332854-129332876 CTGGGGAGGAGGGAAGAGGGAGG + Intronic
1105719487 13:23100053-23100075 CTGGGGGTGAGGGAAGGGGCAGG - Intergenic
1106166010 13:27246970-27246992 CAGTGGCTGAGGCAGGAGGATGG + Intergenic
1106569680 13:30915714-30915736 GTGAGGATGAGGGCAGGGGAGGG + Intronic
1107174617 13:37386056-37386078 CTGAGTATGAGGGAAGAGGGAGG - Intergenic
1107305309 13:39012830-39012852 CCGGGAATGAGGGAAGAGCAGGG + Exonic
1107417179 13:40211541-40211563 TTGTGGGAGATGGAAGAGGAAGG - Intergenic
1107682672 13:42867511-42867533 CTGTGGAAGAGAGAAGAAGCAGG - Intergenic
1107700937 13:43046969-43046991 CTGTGGGTCATGGAAGAGAACGG - Intronic
1108569005 13:51730857-51730879 CTGGGTATGAGGGAAGGAGAGGG + Intronic
1109742318 13:66570239-66570261 CCATGGATTAGGGATGAGGAGGG + Intronic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110299768 13:73912857-73912879 CTGTGAGTGAGGGGAGAAGAAGG - Intronic
1110580529 13:77118390-77118412 CTGTGTACTAGGGAAGAGGGAGG + Intronic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110817471 13:79878043-79878065 CTGTGGATGAAATAAGGGGATGG + Intergenic
1111021895 13:82460650-82460672 CTCTGGATGATGGTAGAGAAAGG + Intergenic
1111520666 13:89399046-89399068 CTGGGGGTTAGGGATGAGGAAGG - Intergenic
1111745963 13:92270035-92270057 CTGTGGTTCAGGGAAGGGTAAGG + Intronic
1113578576 13:111412044-111412066 CTGTGGATCTGGGAAGACGGAGG - Intergenic
1113618465 13:111697239-111697261 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113623994 13:111782500-111782522 CTGTGGAGGAAGGGAGAGGAAGG - Intergenic
1113673189 13:112188868-112188890 CTGTAGACTAGGAAAGAGGAAGG + Intergenic
1113707128 13:112442179-112442201 CTGTGCTTGAGGGCAGAGGTCGG + Intergenic
1113751288 13:112778051-112778073 CTGTAGAAGAAGGAACAGGAAGG - Intronic
1114551584 14:23535456-23535478 CTGGTGTTCAGGGAAGAGGATGG - Intronic
1114553417 14:23547482-23547504 ATGTGGAGGAGGGAAGAGAAAGG - Intronic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1116604889 14:46979310-46979332 TTGTGTCTCAGGGAAGAGGAAGG - Intronic
1117574199 14:57081755-57081777 GTGTGGATGAAGGAGGAGGGAGG - Intergenic
1118771438 14:68945286-68945308 CAGTGCAGGAGGGAAGAAGAGGG + Intronic
1119564526 14:75617072-75617094 CAGTGGATGGTGGAAGAGGATGG + Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1119863917 14:77957286-77957308 CTGGGGATGGGGGAACAAGAAGG - Intergenic
1121153666 14:91663064-91663086 AGGTGGAGGAGGGAGGAGGAAGG - Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121222601 14:92297883-92297905 AAGAGGATGAGGGAAAAGGAAGG - Intergenic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122074067 14:99224468-99224490 GTGTGAATGAAGGCAGAGGAAGG - Intronic
1122778784 14:104134936-104134958 CTGTGGGGGAGGGAGGAGGGTGG + Intergenic
1122842160 14:104471254-104471276 GGGTGGATGCAGGAAGAGGAGGG + Intergenic
1122978335 14:105180148-105180170 CACTGGATGTGGGAAAAGGATGG + Intronic
1123052575 14:105553108-105553130 TTGTGGATGAGATAAGAGGAAGG - Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1123542316 15:21306563-21306585 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123986280 15:25649160-25649182 CTGTGTAGGGGAGAAGAGGAGGG + Intergenic
1124180259 15:27466733-27466755 AAGTGGCAGAGGGAAGAGGAAGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125545947 15:40505145-40505167 CTGTAGGTGAGGGCATAGGAGGG + Intergenic
1125760917 15:42094806-42094828 CTGAGGCTGAGGGCAGAGGATGG + Intergenic
1125796860 15:42409764-42409786 CTGAGGAGGAAGGGAGAGGAGGG - Intronic
1125921653 15:43528835-43528857 CTATGGATGGGGGCAGAGGTGGG - Exonic
1126664798 15:51066634-51066656 CTGTGGGTGAATGATGAGGAAGG + Intronic
1126868501 15:52962296-52962318 GCGTGTATGAGGGAAGAAGAAGG - Intergenic
1127259642 15:57318856-57318878 CTGTGAAGGAAGGAAGAGGGAGG + Intergenic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128072452 15:64806379-64806401 CTGTGGCTCAGGGAATGGGAAGG - Intergenic
1128111887 15:65081708-65081730 CTATGGAAGAGGGAAGAGAAAGG - Intergenic
1128145884 15:65332296-65332318 CTGGGGAGGAGGGAAGAGGGAGG - Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128286719 15:66443189-66443211 CTGTGGCTGAGGCAGGAGAATGG - Intronic
1128591341 15:68900531-68900553 CTTTGGTTGGGGGAAGAGGGAGG - Intronic
1128724687 15:69979609-69979631 CTTTGCATTAGGGAAGAGGTGGG + Intergenic
1128997755 15:72309428-72309450 ATGTGGACCCGGGAAGAGGAGGG + Intronic
1129267694 15:74402847-74402869 GTGTGGAGGTGGGAAGAGGCAGG + Intergenic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1130106844 15:80935133-80935155 CTGTAGGTGTGGGCAGAGGAAGG + Intronic
1130107802 15:80942178-80942200 CTGGGGATACGGGAAGAGGAGGG + Intronic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130253340 15:82314618-82314640 GAGTGCATGAGGGAAGATGATGG + Intergenic
1130398129 15:83522480-83522502 CTGTTGATAAAGGAAGAGGCAGG + Intronic
1130558959 15:84944073-84944095 CTGTGGGTGTGGGAACAGGCAGG - Intronic
1130561686 15:84963926-84963948 CTGTGGAAGAGCCGAGAGGAAGG - Intergenic
1131135405 15:89930962-89930984 CCGGGGCAGAGGGAAGAGGAAGG + Intergenic
1131315043 15:91328688-91328710 CTCTGCTTGAGGAAAGAGGAGGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1202950633 15_KI270727v1_random:33704-33726 CAGGGGATGAGGCAGGAGGATGG + Intergenic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132463874 16:68685-68707 ATGAGGCTGAGGGACGAGGAGGG + Intronic
1132992724 16:2805356-2805378 CTGGACATGAGTGAAGAGGAGGG - Intergenic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133443169 16:5837480-5837502 CTGTGGAGGAGGGCAGAGGGTGG - Intergenic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133803406 16:9103710-9103732 CTGTAGATGGTGGGAGAGGATGG + Intronic
1133871308 16:9689078-9689100 CTGTGGCTGAGGGAAGAGAATGG - Intergenic
1133943880 16:10332616-10332638 GAGTGGCTGAGGCAAGAGGATGG - Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134303874 16:13014746-13014768 ATTTGTATGGGGGAAGAGGAGGG - Intronic
1137363336 16:47840158-47840180 CTGGGGAGGAGGGGAGAGGTCGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137931302 16:52590036-52590058 CAGAGAAGGAGGGAAGAGGAAGG + Intergenic
1138163899 16:54781707-54781729 ATGTGGATGTGGGAGTAGGAAGG - Intergenic
1138406546 16:56799504-56799526 CTTTTGATGAGGGAAAAGAAAGG + Intronic
1138594341 16:58021865-58021887 ATGTGGGTGAGGGATGAGGGTGG - Intergenic
1139651350 16:68363749-68363771 CTGGGGCTGGGGGAGGAGGATGG - Intronic
1139692919 16:68652475-68652497 TGGAGGATGATGGAAGAGGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141461150 16:84179524-84179546 CTGCGGAGGGAGGAAGAGGAAGG - Exonic
1141749709 16:85950138-85950160 CTGTGGGTGAGGGAGGAAGTAGG + Intergenic
1142110320 16:88327658-88327680 CGGTGGAGGAGCGGAGAGGAGGG - Intergenic
1142186294 16:88696284-88696306 CTGTGGGTGTGGGAACAGGGTGG + Intergenic
1142379645 16:89724010-89724032 CTGAGGAAGAGGGAAGAATAGGG + Intronic
1142382678 16:89742351-89742373 CAGAGGCTGAGGTAAGAGGATGG + Intronic
1142484339 17:236945-236967 CTGTCGATGATGGATGAGGAGGG - Intronic
1142485682 17:246429-246451 CTGCGGCTCAGAGAAGAGGAGGG - Intronic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142577826 17:921194-921216 CTGTAGGTGGAGGAAGAGGAAGG - Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142867417 17:2799194-2799216 CGTTGAATGGGGGAAGAGGAGGG + Intronic
1142985890 17:3695267-3695289 ATGAGGATGGGGGAAGGGGATGG + Intronic
1143046591 17:4085700-4085722 CTGTCGATTAGGAAAGAAGATGG + Exonic
1143321759 17:6072889-6072911 GTGTGGATGTGAGAAGTGGATGG + Intronic
1143387145 17:6537828-6537850 CTGTGGATGTGCCAAGAGCAGGG - Intronic
1143963429 17:10739000-10739022 GAGTGGAAGAGAGAAGAGGAAGG - Intergenic
1144082113 17:11772921-11772943 CTGTGAACAAGGCAAGAGGAAGG - Intronic
1144268107 17:13591149-13591171 CGGAGGCTGAGGTAAGAGGATGG - Intronic
1144722481 17:17481088-17481110 CTGGGGAGGAGGGAAGAGCCAGG + Intronic
1144791554 17:17862398-17862420 CTGTGGATGAGGGGCCAGGCAGG + Intronic
1146465603 17:33083890-33083912 CTGAGGATGTGGGTTGAGGAAGG + Intronic
1146517193 17:33498499-33498521 CCCTGGGTGAGGGAAGAGCAGGG + Intronic
1146694517 17:34898418-34898440 CAGCGGTAGAGGGAAGAGGAGGG - Intergenic
1146974066 17:37096151-37096173 GTGTGGAGGAGGGAATTGGAGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147935599 17:44008856-44008878 CTGGGGATTAGGGGAGGGGAGGG + Exonic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1148578911 17:48729522-48729544 GTGAGGCTGAGGGAAGAGGCGGG + Intergenic
1148633387 17:49129215-49129237 AGGAGGATGAGGGAGGAGGAGGG + Intergenic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1149450740 17:56748206-56748228 CTGGGGGTGGGGGTAGAGGAAGG - Intergenic
1150227710 17:63532826-63532848 ATGAGGCTGAGGGAGGAGGAGGG + Intronic
1150580471 17:66469171-66469193 CTCTGGCTGGGGGTAGAGGAGGG - Intronic
1151143329 17:72016220-72016242 CTGGGGAAGAGGGGACAGGAAGG + Intergenic
1151177085 17:72297618-72297640 ATGAGGCTGAAGGAAGAGGAAGG + Intergenic
1151404407 17:73877453-73877475 CTGTGGATGGGAGGTGAGGAAGG - Intergenic
1151654624 17:75490168-75490190 CTGGGGAGGAGGGAAGGGAAGGG - Intronic
1151691366 17:75688069-75688091 GTGAGCATGAGGGTAGAGGAAGG + Intronic
1151756827 17:76080037-76080059 TTGTAGATGGGGGAAAAGGAGGG - Intronic
1151773056 17:76177507-76177529 ATGAGCATGAGGGAAGGGGAAGG + Intronic
1152349382 17:79775870-79775892 CTGTGGGTGATGGAAGTGGATGG - Intergenic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1153041239 18:814370-814392 CTGTGCAGGAGGGAAAAGTAGGG - Intergenic
1153504327 18:5780262-5780284 CTCTGGGCTAGGGAAGAGGAAGG - Intergenic
1154016908 18:10626986-10627008 CTGTGGTGGAGGGAAGGTGAGGG - Intergenic
1154188599 18:12208658-12208680 CTGTGGTGGAGGGAAGGTGAGGG + Intergenic
1155077547 18:22373820-22373842 CTGTGGCTGAGTGAAGAGAGTGG + Intergenic
1155111145 18:22715749-22715771 AGGAGGATGATGGAAGAGGAAGG - Intergenic
1155178458 18:23322225-23322247 TTGTGGTTTAGGGAGGAGGATGG + Intronic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1157385932 18:47260200-47260222 CAGTGGAGAAGGGAAGAGGGAGG - Intergenic
1157742892 18:50109098-50109120 CTGTGGATAGGGGAAGTGGTGGG - Intronic
1157989124 18:52473924-52473946 CTGAGGATGTCAGAAGAGGAAGG - Intronic
1158228863 18:55231088-55231110 TTGGGGGTGAGGGCAGAGGAGGG - Intronic
1158667713 18:59447956-59447978 GTGTGGAAGAGGGCACAGGAGGG - Intronic
1158887305 18:61840425-61840447 CTGTGGCACAGGGCAGAGGATGG + Intronic
1159091367 18:63852796-63852818 CTGCGGTTGAGATAAGAGGAAGG + Intergenic
1159367545 18:67488415-67488437 CAGTGGATAGGAGAAGAGGAAGG - Intergenic
1159625118 18:70684195-70684217 CTGAGAATGAGGGAAGAGGCAGG - Intergenic
1159994897 18:74955071-74955093 CAGTGTTTGAGGGGAGAGGAAGG + Intronic
1160030839 18:75258165-75258187 CTGTGGAGGAGCACAGAGGAAGG - Intronic
1160059663 18:75517576-75517598 CTGTGGATGTGGGCACAGGCAGG + Intergenic
1160265521 18:77338615-77338637 GGGTGGGTGAGAGAAGAGGAGGG + Intergenic
1160377878 18:78427710-78427732 CTGAGGCTGAGGGAGGAGAATGG - Intergenic
1160405980 18:78646739-78646761 CAGGGGATGTGGGAACAGGAGGG - Intergenic
1160520349 18:79504797-79504819 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520364 18:79504854-79504876 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520379 18:79504911-79504933 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520407 18:79505025-79505047 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520435 18:79505139-79505161 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520450 18:79505196-79505218 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520478 18:79505310-79505332 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520532 18:79505538-79505560 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520573 18:79505709-79505731 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520587 18:79505766-79505788 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520602 18:79505823-79505845 CCTTGGGTGAGGGAAGAGGCAGG + Intronic
1160520616 18:79505880-79505902 CCTTGGATGAGGGAAGAGGCAGG + Intronic
1160689856 19:456486-456508 GTGTTGCTGAGGGAGGAGGAGGG - Intronic
1161012694 19:1968080-1968102 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012730 19:1968188-1968210 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161012789 19:1968358-1968380 CTGGGGAGGAGGGAGGAGGGAGG - Intronic
1161206109 19:3042140-3042162 GGGTGTAGGAGGGAAGAGGAGGG + Intronic
1161271020 19:3389341-3389363 CTGGGGTTGAGGGGAGTGGAGGG + Intronic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1161604868 19:5209114-5209136 TGGTGGATGATGGAAGATGATGG - Intronic
1161643362 19:5437285-5437307 CTGCGGATGAAGGGTGAGGAGGG + Intergenic
1161679989 19:5675201-5675223 CTCTGGAAGAAGGAAGAGGCAGG - Intronic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162203453 19:9038075-9038097 CTGAGGATGAGGGAAGAAGATGG - Intergenic
1162435079 19:10653509-10653531 CTGTCAATGGGGGAAGGGGAAGG + Intergenic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163203236 19:15783113-15783135 TTGTGGTTGAGATAAGAGGAAGG - Intergenic
1163447179 19:17353530-17353552 GTGTGTTTGAGGGAAGAGGCCGG - Intronic
1163939045 19:20476242-20476264 CTTTGGAGGAGTGAAAAGGAGGG + Intergenic
1164561161 19:29293194-29293216 CTGTGGAAGAGGCCACAGGAAGG + Intergenic
1164933655 19:32194880-32194902 CTATGGAAGATGGAAGGGGAGGG - Intergenic
1165175423 19:33925899-33925921 GTGAGGCTGAGGCAAGAGGATGG + Intergenic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165394684 19:35557898-35557920 CTGTGGACGAGGGAACGGGGCGG + Intronic
1165433037 19:35783124-35783146 CTGAGGAGGAGAGAGGAGGAGGG + Intronic
1166060517 19:40322629-40322651 CTAAGAAAGAGGGAAGAGGACGG + Intronic
1166312511 19:41970601-41970623 CGTTGGATGAGGGCAGAGGAGGG - Intronic
1166351255 19:42199466-42199488 CTGTTGCTGATGGAGGAGGAAGG - Exonic
1166556834 19:43705725-43705747 CTGTGGGGGAGAGAAGAGAAAGG - Intergenic
1167153587 19:47724439-47724461 CAGTGGATGGGGGCAGAGGAGGG + Intronic
1167219278 19:48186932-48186954 CTGGGGGTGGGGGAAGAGTAAGG + Intronic
1167244253 19:48364320-48364342 CTGTGGAGGAGCGAAAAGGCGGG + Intergenic
1167324892 19:48818382-48818404 CTGAGGAGGAGGGCAGAGGCTGG - Intronic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167645378 19:50702729-50702751 CCTTGGGTGGGGGAAGAGGACGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168255972 19:55165575-55165597 CTGTGTTTGAAGGAAGAGGCTGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1168652062 19:58097845-58097867 CTGTGGGTGGGAGAACAGGAAGG - Intronic
925055149 2:851458-851480 CTGTGCATGAGGGCAGAGTCTGG - Intergenic
925058814 2:875634-875656 CTGTGCATGAGGGCAGAGCCTGG + Intergenic
925292395 2:2756398-2756420 CTGTGGTTGAGGGACAGGGAAGG - Intergenic
925998150 2:9308539-9308561 CTGTGTAAAAGGGAACAGGAGGG + Intronic
926127421 2:10280128-10280150 CTGAGGAAGAGAGGAGAGGAAGG - Intergenic
926321215 2:11749445-11749467 CTGTGGAAAGAGGAAGAGGAAGG - Intronic
926594105 2:14771265-14771287 CTGAGGTGGATGGAAGAGGATGG + Intergenic
926684640 2:15689572-15689594 CGGTGGAGGAGGGCAGAGGCAGG + Intergenic
926934596 2:18074267-18074289 CTGAGGATGAGGGGACAGGGAGG - Intronic
927476835 2:23420147-23420169 CTGGGCAGGAGGGAACAGGAGGG - Intronic
927502491 2:23591893-23591915 CTGGAGATAAAGGAAGAGGAAGG - Intronic
927513330 2:23658124-23658146 ATGGGGAGGAGGGTAGAGGAAGG - Intronic
927569725 2:24148274-24148296 CCGTGGGAGAGGGAAGAGCATGG - Intronic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928295329 2:30077728-30077750 CTGGGGCTGACGGAAGGGGATGG - Intergenic
928998369 2:37321473-37321495 GTGTGCATGGGGGAAGGGGAAGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
930155876 2:48107135-48107157 CTGTGGATGATGCAAGGGAATGG - Intergenic
930749611 2:54920921-54920943 CAGTGGATGTGAGAAAAGGATGG + Intronic
930752909 2:54949446-54949468 CTGTGGCTGAGGGGAGTTGAGGG + Intronic
931784819 2:65609195-65609217 CCGTTGGTGAGGGCAGAGGATGG - Intergenic
931825342 2:65994684-65994706 CTGTGGATGATGGAAGATCTTGG - Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
932355421 2:71064562-71064584 CTGTTGATCTGGGATGAGGAAGG - Intronic
932459067 2:71870810-71870832 CTGTGGAAGAGACAAGAGAAAGG + Intergenic
932594245 2:73084257-73084279 GTGTGGAGCAAGGAAGAGGAAGG - Intronic
932690423 2:73908402-73908424 CTGTAGGAGAGTGAAGAGGAGGG + Intronic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935540883 2:104347352-104347374 GGGTGGCTGAGGGAGGAGGATGG + Intergenic
935832161 2:107011533-107011555 CTGTGGATGAGAGAAGCTGAGGG - Intergenic
936020050 2:108988041-108988063 CTGGGGACTGGGGAAGAGGACGG + Intronic
936649283 2:114407760-114407782 CTGTGGATGAAGGATTATGAAGG - Intergenic
936664270 2:114576345-114576367 GTCTTGAAGAGGGAAGAGGAGGG + Intronic
936692150 2:114902958-114902980 CTGGGAATGAGGGAGGAGGGAGG - Intronic
936933576 2:117815333-117815355 GTGTGGAAGTGGGTAGAGGAAGG - Intronic
936996568 2:118420789-118420811 CTGTGGAAGAGGGAAGAGCATGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
937913723 2:127088772-127088794 CTGGGGGTGAGGGGAGAGGGCGG + Intronic
938413721 2:131087138-131087160 CTGTGGAGGAGGGAAGAAATAGG + Intronic
939082817 2:137683885-137683907 CTTAGGATGAGGCAAGATGATGG - Intergenic
939476653 2:142695591-142695613 TTGTGGTTGAGATAAGAGGAAGG - Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
939979394 2:148760133-148760155 CTGAGGCTGAGGGAGGAGGGAGG + Intronic
940184809 2:150972177-150972199 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
940296271 2:152128306-152128328 CTGAGGCTGAGGGAAGAGAATGG + Intronic
940861851 2:158778877-158778899 CTGGGGATTAGGAAAGAGGTTGG + Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941591659 2:167427871-167427893 TTGTGGAAGAGGGAAAAAGAAGG - Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
941735077 2:168965293-168965315 GTCTGGGGGAGGGAAGAGGAGGG - Intronic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
942301888 2:174570999-174571021 CTGTGGATGGGGGCATTGGAAGG + Intronic
942602099 2:177652146-177652168 GCTTGGATGAGGGAAGAGGTTGG + Intronic
944404905 2:199373149-199373171 CCCTGTCTGAGGGAAGAGGAGGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944486271 2:200209638-200209660 CTGAGAATAAGGGAAGAAGATGG + Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
945249740 2:207754740-207754762 GTGTGGCTGAGGCTAGAGGATGG - Exonic
945461617 2:210116197-210116219 CTCTGCTTGAGGAAAGAGGAAGG + Intronic
946407811 2:219501453-219501475 CTGAGGACAAGGGAAGAGGCTGG - Intronic
946563894 2:220941995-220942017 TGGTGGGTGAGGGTAGAGGATGG + Intergenic
946768991 2:223068751-223068773 CTGGGGGTGTGGGAAGAGGAAGG - Intronic
947232455 2:227902044-227902066 CTGTTGAGGAGGGGTGAGGATGG + Intronic
947661207 2:231869980-231870002 GTGGGGAGGAGGGAAAAGGAAGG - Intergenic
947669937 2:231929656-231929678 CTGAAGATGAGGCAAGGGGAAGG + Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948908214 2:240989854-240989876 CCCTGGGTGAGGGAAGAGGCAGG + Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1168877290 20:1180487-1180509 CAAGGCATGAGGGAAGAGGATGG + Intronic
1168910821 20:1445305-1445327 CTGTGGTTGATGGAGGAGAAGGG - Intronic
1169091735 20:2865100-2865122 ATGGGGATGAGGGACCAGGAGGG - Intronic
1169280227 20:4260895-4260917 AACTGGATAAGGGAAGAGGAGGG + Intergenic
1169331887 20:4722793-4722815 GTGTGGATTAGGGAAATGGAAGG - Intronic
1169820910 20:9708929-9708951 GTGTGGATGTGAGCAGAGGAAGG - Intronic
1170408968 20:16067886-16067908 GAGTGGAGGGGGGAAGAGGATGG - Intergenic
1170565663 20:17602356-17602378 CTGTGAATGCCAGAAGAGGAAGG - Intronic
1170685372 20:18564794-18564816 CTCTGAATCAGGGAAGAGAAAGG + Intergenic
1170808798 20:19657374-19657396 CTGTGGGTGAGGGAAGATGTTGG - Intronic
1170825577 20:19792015-19792037 CCATGGTTGGGGGAAGAGGAAGG + Intergenic
1170908395 20:20538370-20538392 CAGTTGAGTAGGGAAGAGGAAGG + Intronic
1172783547 20:37451344-37451366 CTCAGAAGGAGGGAAGAGGATGG - Intergenic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1172839828 20:37896052-37896074 GGGTGGGAGAGGGAAGAGGAAGG - Intergenic
1173531752 20:43775044-43775066 CAGTGGATGTGGAAAGAGGATGG + Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173620734 20:44434080-44434102 TTGGGGATGAGGGTAGAGCAGGG + Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174224391 20:48985199-48985221 GCATGGATGAAGGAAGAGGAGGG - Intronic
1175031215 20:55956204-55956226 CTATGGATGAGGGCAGAGGCAGG + Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175538888 20:59735975-59735997 CTGTTGATGGGGGAAAGGGATGG + Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175649601 20:60707879-60707901 TTGTGGATGAGAGAATAGGGGGG - Intergenic
1175874308 20:62222157-62222179 CTGTGGATGACAGGGGAGGAGGG - Intergenic
1175925503 20:62469399-62469421 CTCTGGTTCAGGGAAGAGGATGG - Intronic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1175959182 20:62626419-62626441 CAGTGGATGAGGCAAGAGTGTGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178007610 21:28240649-28240671 CTGTGGAGGAGGGAGGAGGCAGG - Intergenic
1178613921 21:34113561-34113583 CTGTAGAGCAGGGAAGAGAAAGG - Intronic
1179308160 21:40173683-40173705 CTGGGGTGGAGGGGAGAGGATGG - Intronic
1181520752 22:23448269-23448291 CTGGGGATGCGGGGTGAGGAGGG - Intergenic
1181549873 22:23631737-23631759 CTGGGGATGAGGGTAAGGGAAGG + Intronic
1181798519 22:25327795-25327817 CTGGGGATGAGGGTAAGGGAAGG - Intergenic
1181934258 22:26428136-26428158 CTCTGGAAGAGGGAGGAGGTGGG + Intergenic
1182334082 22:29571460-29571482 CTGTGGTTAAGGGCAGTGGAGGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182900337 22:33893274-33893296 CTGGGGTGGTGGGAAGAGGAAGG - Intronic
1183829453 22:40410024-40410046 CTCAGGAAGAGGGAAGGGGATGG + Exonic
1184478510 22:44734524-44734546 CTCCGGATGAGGGGAGATGATGG + Intronic
1184946529 22:47807887-47807909 CTGTGGTTGAGGGAGTAGGTTGG + Intergenic
1185146660 22:49140898-49140920 CTGTGGCTGATGGAGGAGCATGG + Intergenic
1185243952 22:49763403-49763425 CAGGGGCTGGGGGAAGAGGAAGG + Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
950817881 3:15726115-15726137 TTGTGTCTGAGTGAAGAGGAAGG - Intronic
951215953 3:20025371-20025393 CTGAGGATGAGGGAAAAATATGG - Intergenic
952710477 3:36427005-36427027 TTGTGGATGAGGCAAGAAGGAGG - Intronic
952749551 3:36814366-36814388 ATGGGGAGGAGGGAAGAGCAAGG - Intergenic
952937752 3:38413488-38413510 GTTTGGATTGGGGAAGAGGATGG - Exonic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953315704 3:41924799-41924821 CCAGGGATGAGGGAAGAGGATGG - Intronic
953788674 3:45929964-45929986 TTGAGGCTGAGGGATGAGGAGGG - Intronic
953837865 3:46362711-46362733 CTGTGGAGGATGGAGCAGGAGGG - Intergenic
954135737 3:48581341-48581363 CTGTGGAGGAGGCAAGAGGGAGG + Intronic
954726510 3:52616020-52616042 CTGCTGAGGAGGTAAGAGGAGGG - Intronic
954876469 3:53805967-53805989 CGGAGGAGGAGGGAAGATGAGGG - Intronic
954972437 3:54662599-54662621 CTGAGGCTGAGGGAGGAGGCAGG - Intronic
955331333 3:58049933-58049955 CCGTGGATGGGGGCAGAGGAGGG + Intronic
955738633 3:62066092-62066114 CTCTGGCTGGGAGAAGAGGAGGG + Intronic
956269457 3:67434623-67434645 CTTAGGATGAGAGAAGGGGAAGG + Intronic
956345207 3:68270694-68270716 CTGTGGATGAAGGAACAAGAGGG + Intronic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956836115 3:73097325-73097347 CTGTGCAGTAGGGAAGGGGAAGG + Intergenic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
958730655 3:97957112-97957134 CTGTGGTTGAGGGATGGGCATGG - Intronic
958870389 3:99551719-99551741 GTGAGGAGGAGTGAAGAGGAGGG + Intergenic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959269595 3:104190775-104190797 CTGTGGATGAAGGAAGTTGGAGG + Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960893394 3:122475922-122475944 CTGAGGAGGAGGGAAGAGGAAGG + Intronic
960990494 3:123307637-123307659 GTGGGGGTGAGGGAAGGGGATGG - Intronic
961482576 3:127193490-127193512 CTGGGGCTGAGGGAACAGGCTGG - Intronic
961696954 3:128711991-128712013 CTTTGCATTAGGGAAGGGGAAGG + Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962710482 3:138081654-138081676 CTGGGGGAGAGGGAAAAGGAGGG + Intronic
962738005 3:138342853-138342875 CTGGGGATGAGGGAACAGCTGGG + Intergenic
963922667 3:150920927-150920949 ATGTGGGTGAGGGAAGACCAGGG + Intronic
964036542 3:152206096-152206118 CTGGGCCTGGGGGAAGAGGAGGG - Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965636911 3:170791740-170791762 CTGTGGATCAGAGAACAGTAAGG + Intronic
966869579 3:184281461-184281483 CAATGGATGAGGGAGCAGGAGGG + Intronic
966975390 3:185078583-185078605 CTGAGGAGGAGGGAAGAAGGGGG - Exonic
967007049 3:185394031-185394053 ATGTGGATGTTGGAACAGGAGGG + Intronic
967743334 3:193027194-193027216 TTAAGGATGAGGGAAGAGGCTGG - Intergenic
967948271 3:194821035-194821057 CTGTGGTTGAGGGAAGCAGAGGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968230231 3:197001483-197001505 CTGTGGATGGGTGCAGAGAAGGG - Intronic
968282219 3:197485551-197485573 TTGTGAATGAGAGAAAAGGAGGG - Intergenic
968543135 4:1178400-1178422 CTGAAGATGAGGGAGGGGGAGGG - Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969622537 4:8285893-8285915 CTGGGGGTGAGGGTAGAGGGAGG + Intronic
970175934 4:13339482-13339504 CTGTGATTTAGGGAAGAGCATGG + Intergenic
970325577 4:14920175-14920197 CTGAGGATCAGGGAAAGGGATGG + Intergenic
970953907 4:21788469-21788491 CTGTAGATGAGGTTAGAGGCTGG - Intronic
971458318 4:26866172-26866194 TTGTGGGGGAGGTAAGAGGAGGG - Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
972802569 4:42492522-42492544 CTGTGCATGATGGAAGAAGAAGG - Intronic
972872280 4:43314209-43314231 CAGTAGATCAGAGAAGAGGAAGG + Intergenic
973705576 4:53576657-53576679 TTGGGGCTGAGGGAAGAGGCAGG - Intronic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974910105 4:68107602-68107624 AAGTGGAAGAGGGAAGATGATGG + Intronic
975314290 4:72933505-72933527 TTGTGGTTGAGGAAAGAAGAGGG - Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
975714099 4:77189185-77189207 CTGTGGAGGAGGAAACAGGGAGG - Intronic
976165606 4:82251543-82251565 CTAGGGATGGGGGCAGAGGATGG + Intergenic
976468503 4:85399386-85399408 TTGTGTCTGAGGGAATAGGAAGG - Intergenic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
978556700 4:109988727-109988749 CTGGGGAGGAGGGCAGAGGCAGG + Intronic
979340033 4:119511796-119511818 CTTTGGCTGAGTGAAGAGAAAGG + Intronic
979696655 4:123620435-123620457 GAGTGGATGAGGGAAGAAGAAGG + Intergenic
979778908 4:124624813-124624835 CTTGGGATGAGAGAAGAGAAGGG - Intergenic
983652919 4:170051585-170051607 TGGTGGCTGAGGGAAGAGCAAGG - Intergenic
983740153 4:171120771-171120793 CTGTGGAATTGGGAAGACGATGG - Intergenic
983963248 4:173779419-173779441 CTGTGTATCAGGGAATAGGGAGG - Intergenic
984715283 4:182918832-182918854 CGGTGGATTTGGGAGGAGGAGGG - Intergenic
984908016 4:184648464-184648486 CTGAGAATGGGGGAAGAGGCAGG + Exonic
984963716 4:185122765-185122787 CAGTGGATGAAGGAAAGGGAAGG - Intergenic
984985960 4:185329704-185329726 GAGAGGATGAGGGAGGAGGAGGG + Intronic
985330580 4:188827836-188827858 TTGTGGATGAGCAAAGAAGATGG + Intergenic
985356487 4:189125124-189125146 CTGTTGATCCGGGAAGAGGGTGG + Intergenic
986178797 5:5374323-5374345 CTGTGGATGTGAGAGGAGAAAGG + Intergenic
986682694 5:10248650-10248672 CTGGGGCTGAGGCAGGAGGATGG - Intronic
987085876 5:14467299-14467321 CTGTGGATGAAGGAAGAAATGGG - Intronic
987390244 5:17368564-17368586 GGGTGGATGAGGGAAGATGCTGG + Intergenic
987739839 5:21893257-21893279 TTGTGGTTGAGGGAAAAAGAGGG + Intronic
988364471 5:30278122-30278144 GTGGGGATGGGGGTAGAGGAGGG + Intergenic
988372625 5:30390963-30390985 CTGTGGTTGTGGGAATAGAAGGG - Intergenic
988713753 5:33804211-33804233 ATGAAGATGGGGGAAGAGGAAGG - Intronic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
988830083 5:34978543-34978565 CTGGGGCTGGGGGCAGAGGAAGG + Intergenic
989085521 5:37672355-37672377 TTGTGGTTGAGATAAGAGGAAGG + Intronic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989759292 5:44993096-44993118 AGGTGGGAGAGGGAAGAGGAGGG + Intergenic
989987310 5:50716151-50716173 CTATGGAGAAGGGAAGAGGCTGG + Intronic
990385147 5:55253081-55253103 GTGTGGATGCAGGAAAAGGATGG - Intergenic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
991035789 5:62126194-62126216 GTGAGGCTGAGGCAAGAGGATGG + Intergenic
991152185 5:63383263-63383285 GTGTGGGTGGGTGAAGAGGAGGG + Intergenic
992487325 5:77209995-77210017 GTGGGGCTGGGGGAAGAGGACGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993492810 5:88572371-88572393 TAGTGGATGAGGGAAGAGAGAGG - Intergenic
994307626 5:98226105-98226127 CTGAGGATGAGGGGAGAGTAGGG + Intergenic
995890196 5:116942476-116942498 CTGTGGGTGATGGATGGGGATGG + Intergenic
995922185 5:117327658-117327680 CCCTGGATGATGGTAGAGGAGGG + Intergenic
996454493 5:123664406-123664428 CCATGGATGAGGGAAGAGTAGGG + Intergenic
996627328 5:125586105-125586127 CAGAGAAAGAGGGAAGAGGAGGG + Intergenic
997678995 5:135736069-135736091 CTGGGGAGGAGGGGAGAGGTCGG + Intergenic
997690655 5:135825633-135825655 CTGGGTATGAAGGAACAGGAAGG - Intergenic
997735019 5:136206800-136206822 CTGAGGCTGCAGGAAGAGGATGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997846635 5:137292217-137292239 CTCTGGATGAGGGATGAGGAAGG + Intronic
998070047 5:139190737-139190759 CTGTGGATGAGTGAAGAGTCAGG - Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998450079 5:142227486-142227508 CTGGGGGTGAGGGTAGAGGAAGG - Intergenic
998687597 5:144546940-144546962 TGGTGGATGTGGGAAGAGAAAGG - Intergenic
998899145 5:146833746-146833768 CTGGGGGTGGGGGAGGAGGATGG - Intronic
998936705 5:147236647-147236669 CTGTGGAAGGGGGAAGCAGATGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999076232 5:148798328-148798350 CTGTGAAATAGGGAAAAGGAGGG + Intergenic
999084304 5:148873596-148873618 CTGTTGATGAGGAAAGAAAATGG + Intergenic
999196661 5:149786028-149786050 CTGGGGATGGGGGCAGAGGCAGG - Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999784908 5:154882255-154882277 CAGTGGAAGGGGGAAGATGAGGG - Intergenic
1000128696 5:158273658-158273680 TTGAGGGTGAGGGAAGAGGGAGG + Intergenic
1000373695 5:160560312-160560334 GTGTGTGTGAGGGAAGGGGAGGG + Intergenic
1001176664 5:169475416-169475438 CTGTGGATGTGGGAAGAAAGCGG - Intergenic
1001544754 5:172564072-172564094 CTGTGCATGATGGGAGGGGACGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1002204535 5:177553883-177553905 CTGTGGCTGAGGGAGCAGGTGGG + Intronic
1002429364 5:179194163-179194185 CTGCGGAGGAGGGAGGAGGGAGG + Intronic
1002437359 5:179239765-179239787 CAGAGGGTGCGGGAAGAGGAAGG + Intronic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1003841243 6:10122221-10122243 CTGGGGGTGAGGGAGGAGTAGGG + Intronic
1004023652 6:11798095-11798117 CTGTGAATGACTGAAGAGCAAGG + Intronic
1004321562 6:14635387-14635409 CTGTGGCTGAGGGAAGCAGCAGG - Intergenic
1004370618 6:15049192-15049214 CTTTGGATGAGAGAGGAGGGTGG - Intergenic
1004462124 6:15847462-15847484 GTGTGGCTGAGGCTAGAGGATGG + Intergenic
1005682476 6:28220320-28220342 CTCTGGATGTGGCCAGAGGAAGG - Intergenic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1005832167 6:29680104-29680126 CTGTGGATGAAGGAAGTTCATGG - Intronic
1005905258 6:30257475-30257497 CAGTGGTTGAGTGAAGAGAAGGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1006019888 6:31111754-31111776 CTGTGGATGAGAGACCAGGGAGG + Exonic
1006037946 6:31228812-31228834 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006068065 6:31476798-31476820 CTGTGGCTGTAGGTAGAGGACGG - Intergenic
1006088997 6:31616694-31616716 GGGTGGAAGGGGGAAGAGGAAGG - Intronic
1006136062 6:31897205-31897227 CTGGGGCCGAGAGAAGAGGAGGG + Intronic
1006401929 6:33822729-33822751 CTGTGGCTGAGGAAATAGGGCGG + Intergenic
1006580358 6:35073520-35073542 CTGAGGAAGAGGGGACAGGAGGG - Intronic
1006603590 6:35241686-35241708 CTTTGGAGGAGAAAAGAGGAAGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006705080 6:36012964-36012986 CTGTGGAGGAGAGGAGAGCATGG + Intronic
1006929510 6:37679334-37679356 CTGTGGATGCGGGAGGAGGGAGG + Intronic
1006933535 6:37701809-37701831 CTGGGGGTGTGGGATGAGGAGGG - Intergenic
1007520381 6:42447557-42447579 GTGTGGCTGAGGGAGGAGGAAGG - Intronic
1007663012 6:43497884-43497906 CTGTGGCTAAAGGAAGTGGAGGG + Exonic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1010399412 6:75431157-75431179 CTGAGCATGAGGGCAGAGGAAGG + Intronic
1011207724 6:84918347-84918369 GTGTGTATCAGGGGAGAGGATGG + Intergenic
1011722003 6:90167080-90167102 CTGTGGACCATGGAACAGGAAGG + Intronic
1012171933 6:96027387-96027409 CTGTGCATCAGGGCAGAGAAAGG - Intronic
1012631274 6:101470617-101470639 CTGGGGATGGGGGAAGAGTAGGG + Intronic
1012776505 6:103500842-103500864 GTGGGGATGAGGGGAGAGGATGG - Intergenic
1013422384 6:109978494-109978516 TTGAGGATGTGGGGAGAGGAGGG + Intronic
1015282792 6:131451955-131451977 CTGTGGGTGGAGGAAGAGGTGGG - Intergenic
1015543919 6:134343239-134343261 CTGTGGTTGGGTGAATAGGAAGG + Intergenic
1016446294 6:144135798-144135820 GTGTAGATGAGAGAAGATGAGGG + Intergenic
1016882583 6:148925152-148925174 CTGTGTATGAGAGAAAAAGAAGG + Intronic
1017513206 6:155132424-155132446 CTCTGTGTGAAGGAAGAGGAGGG - Intronic
1017676515 6:156819983-156820005 CTGTGGTGGAGAGGAGAGGAAGG + Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1019590487 7:1827978-1828000 CTGGGGATGCGGGGTGAGGAGGG + Intronic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1020765054 7:12308938-12308960 CTGTGTCTCAGGGAAGAGGGAGG + Intergenic
1021464767 7:20929785-20929807 CTGGGGGTGGGGGAGGAGGAGGG - Intergenic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1022369687 7:29758788-29758810 CTTTTGCTGAGGGAAAAGGAGGG - Intergenic
1022544037 7:31168800-31168822 CTGTGGAAGAAAGAAGAGGTTGG - Intergenic
1023604308 7:41914717-41914739 CTGGGGAAGAGGGAAGAAGGAGG + Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1024880364 7:54078851-54078873 CTGTGGAAGAGCAAAGAGGGAGG + Intergenic
1025016272 7:55441230-55441252 CTGGGGAGGAGGGAAGGGGGAGG + Intronic
1025017661 7:55452197-55452219 CTATGGATGAGTGAAGAAGGTGG - Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026420079 7:70226290-70226312 CTGAGGCTGAGGCAAGAGAATGG - Intronic
1026469300 7:70681280-70681302 CTGTTGTTGAGGGAGGAGTAGGG + Intronic
1026896482 7:74012849-74012871 CTGTGAATGAGGTGTGAGGAAGG + Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027713506 7:81639644-81639666 CCAAGTATGAGGGAAGAGGAAGG + Intergenic
1027989361 7:85336786-85336808 GAGTGGATGAGGGTAGGGGAAGG + Intergenic
1028153959 7:87408084-87408106 CAGTGGCTGTGGGAAGAGCACGG - Exonic
1028163714 7:87514417-87514439 CTGGGGATGAGGGAAGTGTCTGG - Intronic
1028440172 7:90850597-90850619 CTGTGGAAGAGGGAACAGAAAGG + Intronic
1028505504 7:91566075-91566097 CGGTGTATGAGGAAAGTGGAAGG - Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1029590715 7:101505048-101505070 CAGAGGCTGAGGGAGGAGGATGG + Intronic
1029692503 7:102191583-102191605 TTTTGGAAGAGGGAAGAAGAGGG - Intronic
1029705047 7:102271648-102271670 GAGGGGATGAGGGAAGAGGCAGG - Intronic
1030618043 7:111758858-111758880 CTATGGCAGAGAGAAGAGGATGG + Intronic
1030975695 7:116120200-116120222 CTGTGTTTCAGGGAAGAAGATGG + Intronic
1031423923 7:121583390-121583412 TTGGGGATGAGGGAAGAGAAAGG + Intergenic
1031878378 7:127167767-127167789 TTGTGTCTGAGGGAATAGGAAGG - Intronic
1032180882 7:129676464-129676486 CTGTGTCTCAGGGAACAGGAAGG + Intronic
1032263788 7:130356478-130356500 CTGGGGCTGGGGGAAGGGGATGG - Intronic
1032738161 7:134711875-134711897 TGGTGGAGGAGGGAAGAGAAAGG + Intergenic
1032840244 7:135707772-135707794 CTGTGTATCAGGGAACAGGCTGG - Intronic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033724808 7:144103618-144103640 GTGAGGATGAGGGACCAGGAGGG - Intergenic
1033780663 7:144665077-144665099 CTGTTGTTGAGGGGAGGGGAGGG + Intronic
1033912738 7:146285669-146285691 AGGGAGATGAGGGAAGAGGAGGG - Intronic
1034183113 7:149153986-149154008 CTGGGGGTGTAGGAAGAGGAAGG - Exonic
1035277627 7:157757511-157757533 CTTTGGATACGGGCAGAGGAAGG + Intronic
1035545372 8:478187-478209 CTGGGCAGGAGGGGAGAGGAGGG - Intergenic
1035675324 8:1451862-1451884 CTCTGGTGGAGGGAACAGGATGG - Intergenic
1035707442 8:1688130-1688152 CTGGGGGTGAGGGGAGTGGAGGG - Intronic
1035712579 8:1729827-1729849 TTTTGGGAGAGGGAAGAGGAAGG - Intergenic
1036589277 8:10153263-10153285 ATGTGGATGAGGCATGAGGTGGG + Intronic
1037173491 8:15921297-15921319 CTGTGAATCAGGGAAGCTGATGG + Intergenic
1038156306 8:24993961-24993983 CTGAGGGTGAGGGAAGAAGGAGG + Intergenic
1038257777 8:25966428-25966450 GTGTGGATGAGGGTAGAGTCCGG - Intronic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038378297 8:27065596-27065618 CTGTTGATTAAGGAAGAGGCAGG + Intergenic
1038642916 8:29341756-29341778 TAGAGGATGAGGGAAGAGGAAGG + Intronic
1039451434 8:37677827-37677849 CTGTGGATGAGAGGAGAGCTGGG - Intergenic
1040388499 8:46930821-46930843 CAGTGAGGGAGGGAAGAGGAGGG + Intergenic
1040532187 8:48275116-48275138 GTGTGGAATAGGGGAGAGGAGGG + Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1041178431 8:55221873-55221895 CAGTTCATGAGGAAAGAGGAGGG + Intronic
1041298611 8:56388270-56388292 CTGTTGGTGAGAGATGAGGATGG + Intergenic
1041345162 8:56889408-56889430 TAGTGGATGAGGGAAGTGGGTGG + Intergenic
1041437020 8:57853132-57853154 TTGAAGATGAGGGAAGGGGAAGG + Intergenic
1042089612 8:65144426-65144448 GGGAGGAGGAGGGAAGAGGAGGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1042803365 8:72745103-72745125 CTCTGGATCAGGGAGGTGGAGGG - Intronic
1043382879 8:79722102-79722124 CAGAGGCTGAGGCAAGAGGATGG + Intergenic
1044937525 8:97307653-97307675 TTGAGGGTGAGGGCAGAGGAGGG - Intergenic
1045041557 8:98229125-98229147 TTGGGCATGAGGGCAGAGGATGG - Intronic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1045112487 8:98948173-98948195 ATGGGGCTGAGGGCAGAGGAAGG + Exonic
1045225793 8:100244480-100244502 CTGGTGATGAGTCAAGAGGAGGG - Intronic
1045416899 8:101976424-101976446 GTGTGAGTGAGGGAAGGGGAGGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045816611 8:106283996-106284018 CTGTGCATTTGGGAAGAGGCTGG - Intronic
1046461178 8:114538333-114538355 CAGTAGATGCAGGAAGAGGAGGG + Intergenic
1046516935 8:115274707-115274729 GTGTGGATGGTGGCAGAGGAAGG + Intergenic
1046708412 8:117481095-117481117 ATGTGGATGTGGAAAGAAGAAGG + Intergenic
1047318899 8:123760494-123760516 CTGTAAATAAGGGAAGAGGATGG - Intergenic
1047356116 8:124123770-124123792 CAGTAGATGAGGGAAGCGGAGGG + Intergenic
1047614918 8:126556280-126556302 CTGTGGACGGGGGAGGAGGAAGG - Exonic
1047775870 8:128069978-128070000 CTATGGAGGAGGGAAGGGAATGG - Intergenic
1047948813 8:129910691-129910713 GTGTGGCTGAGACAAGAGGATGG + Intronic
1047967644 8:130058267-130058289 CTGATGATGGGGGGAGAGGAAGG - Intronic
1048274134 8:133053107-133053129 CGGTGAAGGAGGGAAGAGCAGGG - Intronic
1048364929 8:133730254-133730276 CTGCGGAGGAGGGTGGAGGAAGG + Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049201209 8:141341492-141341514 GTGGGGGTGGGGGAAGAGGAGGG + Intergenic
1049257950 8:141623892-141623914 CTGTGGCCGAGGGAACAGCAGGG - Intergenic
1049288380 8:141788821-141788843 ATTTGGATGTAGGAAGAGGAGGG - Intergenic
1049357810 8:142197298-142197320 CTGGGGAGGAGGCAAGAGGCAGG - Intergenic
1049831118 8:144701120-144701142 CTGAGGATGAGGCCAGAGGTGGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050290469 9:4148875-4148897 CTGTGGAGGAGAGAGGAGAATGG - Intronic
1050437892 9:5629088-5629110 GTGTGGGGGAGGGAAGGGGAGGG - Intronic
1050740174 9:8810856-8810878 CTGTGGATGAGGGAAGGCAGGGG + Intronic
1050909185 9:11045579-11045601 CTGTGGATGATAGCAGTGGAGGG - Intergenic
1051601536 9:18879150-18879172 TTGTGGGAGAGAGAAGAGGAGGG + Intronic
1051893804 9:21968605-21968627 CTGGGGATGCGGGAAGGGAAAGG - Exonic
1053036182 9:34828207-34828229 TTGTGGATAAGGGAAGAAAAAGG - Intergenic
1053037513 9:34837948-34837970 CTGAGGATGAAGCAAGAGAAAGG + Intergenic
1053423517 9:37996258-37996280 CTGGGTGTGAGGGAAGGGGAGGG - Intronic
1055063097 9:72091151-72091173 AGGAGGATGAGGCAAGAGGATGG + Intergenic
1056478161 9:86973188-86973210 GTGTGTATGTGAGAAGAGGAGGG - Intergenic
1057209408 9:93191563-93191585 TTGGGGATGAGGGTAGAGGCAGG + Intronic
1057302581 9:93895397-93895419 CTGTGGATTGGGGTAGAGGATGG - Intergenic
1057351724 9:94304342-94304364 CTGGGGATCAGGGAACAGGAGGG - Intergenic
1057538994 9:95946981-95947003 CTGTGTCTCAGGGAAGAGGGAGG - Intronic
1057552381 9:96061427-96061449 TTGTGGTTGAGGGACCAGGAGGG - Intergenic
1058067988 9:100570613-100570635 ATGTGGATCATGGAAGAGAATGG - Intronic
1058136524 9:101313820-101313842 CTGGGGATAAGGGAAAAGGAAGG - Intronic
1058467008 9:105238765-105238787 CTTTGGATAAGTGAAGATGATGG - Intergenic
1058619364 9:106865996-106866018 TTGAGGATGAGGGAAGATGTTGG + Intronic
1058754365 9:108070658-108070680 CTGTGGACCAGGGAGAAGGATGG + Intergenic
1059250279 9:112881988-112882010 CTGTGGCTGAGGGTTGGGGAGGG + Intronic
1059354208 9:113686998-113687020 GTAGGGAGGAGGGAAGAGGAAGG + Intergenic
1059434222 9:114266671-114266693 CTGGGGAGGAGGGAAGGGAAGGG - Intronic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1059715964 9:116913506-116913528 CTGGGTTTGAGGGAAGGGGAAGG + Intronic
1060736798 9:126071268-126071290 CGGAGGAGGAGGGAAGAGGGAGG - Intergenic
1060816897 9:126639692-126639714 CTGGGGAGGGGGGCAGAGGAGGG + Intronic
1061006849 9:127933090-127933112 CTGTGACTTAGGGCAGAGGATGG + Intergenic
1061279124 9:129586948-129586970 GTGGGGAGGAGGGAAGAGGGGGG - Intergenic
1061705261 9:132448344-132448366 TGGTGCATGAGGGAAGAGAAAGG - Intronic
1061917034 9:133760666-133760688 CTGAGGATGAGGGATCAGGAAGG + Intergenic
1061917084 9:133760884-133760906 CTGAGGACGAGGGATCAGGAAGG + Intergenic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1062220153 9:135410680-135410702 CTGTGGATCCAGGAAGAGGCAGG + Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1185763938 X:2709094-2709116 CTGAGGGTGATGGAGGAGGATGG + Intronic
1186061953 X:5718588-5718610 CTGGTGATAAGGGAAGATGATGG + Intergenic
1186137430 X:6534235-6534257 CTCTGGTTTAGGGACGAGGATGG + Intronic
1186160201 X:6769421-6769443 CTGTGGATTAATGAAGAGCAAGG - Intergenic
1186298102 X:8170381-8170403 CTCTGGTTTAGGGACGAGGATGG + Intronic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1186550936 X:10504698-10504720 TTTTGGATGGGGGAAGAAGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187419920 X:19125251-19125273 CTATGGAAGAGGAAAGAGGTTGG + Intergenic
1187484312 X:19687696-19687718 CAGTGAATGAGAGAAGAGAAGGG + Intronic
1187877483 X:23816291-23816313 CTGAGGAGTTGGGAAGAGGAAGG - Intergenic
1188236630 X:27739729-27739751 GTGAGGATTAGGGATGAGGATGG - Intronic
1188310485 X:28611113-28611135 TTGTGGAGAAGGGAAGAGGTTGG + Intronic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189005306 X:36987823-36987845 TTATGGTTGAGGGATGAGGAAGG - Intergenic
1189043721 X:37570119-37570141 TTATGGTTGAGGGATGAGGAAGG + Intronic
1189226974 X:39421214-39421236 CTGTGGAGGAATGAAGAGGCAGG + Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190148972 X:47925315-47925337 CTGTGGATGTGGGAAGAATGTGG - Intronic
1190210434 X:48442370-48442392 CTGAGGCTGAGGCAAGAAGAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1192057177 X:67784879-67784901 GTGGGGGTGAGGGAAAAGGAAGG - Intergenic
1192191485 X:68994019-68994041 GTGAGGATGAGGGAAGAGGATGG + Intergenic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192705119 X:73521047-73521069 CAGTGGATGAGGGTTCAGGAAGG + Intergenic
1192986940 X:76409753-76409775 CTGTCAGTGAAGGAAGAGGAAGG + Intergenic
1193477955 X:81990224-81990246 AAGTGGAGGAGGGAAGAGAAAGG + Intergenic
1193918150 X:87392642-87392664 CTGTGGAGGGGGGAAGAGTAAGG + Intergenic
1194071897 X:89335328-89335350 TTGTGGAGGAGGGAAAAGGCAGG - Intergenic
1194239293 X:91423868-91423890 CTGTGGATGAGGGATGGACAAGG + Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195702110 X:107713409-107713431 CTGTGGATGAGGGATGAACAAGG - Exonic
1195823384 X:108970822-108970844 CTCTGCATGAGGAAAGGGGAGGG + Intergenic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196746131 X:119073127-119073149 CTGTGGCTGAGGGGAGGTGAGGG - Intergenic
1197346360 X:125328122-125328144 CTATGGATGAGGGCATCGGATGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197756470 X:129998816-129998838 CTGCAGATGAGAGGAGAGGAGGG - Intronic
1197869028 X:131048483-131048505 TTATAGATGAGAGAAGAGGAGGG - Intergenic
1199700931 X:150375043-150375065 CTGCTTAGGAGGGAAGAGGATGG + Intronic
1199778602 X:151037709-151037731 TGGTTGATGTGGGAAGAGGAGGG - Intergenic
1199789949 X:151143687-151143709 GAGTGGAGGAGGTAAGAGGAAGG + Intergenic
1199974620 X:152885911-152885933 CTTTGGAGGAGGGAACATGATGG - Intergenic
1200126321 X:153816492-153816514 CGGGAGATGAGGGAAGAGGGGGG + Intronic
1200204992 X:154309355-154309377 TTGTGGATGTGGCAACAGGATGG + Exonic
1200366462 X:155670957-155670979 CTGTGGATGTGGAAAGATTATGG - Intergenic
1200726141 Y:6671057-6671079 TTGTGGAGGAGGGAAAAGGCAGG - Intergenic
1201438777 Y:13986178-13986200 CTCTGGTTTAGGGACGAGGATGG + Intronic
1201445796 Y:14056530-14056552 CTCTGGTTTAGGGACGAGGATGG - Intronic
1201737704 Y:17287248-17287270 CTATGGATGGGGAAACAGGATGG + Intergenic