ID: 1091286730

View in Genome Browser
Species Human (GRCh38)
Location 11:134412196-134412218
Sequence CAGAGTCCCCGAGGTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286723_1091286730 -3 Left 1091286723 11:134412176-134412198 CCGAGCCGACCGGGCCGGCGCAG No data
Right 1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG No data
1091286721_1091286730 3 Left 1091286721 11:134412170-134412192 CCGGAGCCGAGCCGACCGGGCCG No data
Right 1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG No data
1091286724_1091286730 -8 Left 1091286724 11:134412181-134412203 CCGACCGGGCCGGCGCAGAGTCC No data
Right 1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286730 Original CRISPR CAGAGTCCCCGAGGTGGCGG CGG Intergenic
No off target data available for this crispr