ID: 1091286856

View in Genome Browser
Species Human (GRCh38)
Location 11:134412555-134412577
Sequence GGTGGAATGGGGGTGCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286856_1091286868 2 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286856_1091286876 30 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286856_1091286863 -8 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286863 11:134412570-134412592 ATTCCACCCCGCCTCCATCCTGG No data
1091286856_1091286872 14 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286856 Original CRISPR GGTGGAATGGGGGTGCAGGC GGG (reversed) Intergenic