ID: 1091286857

View in Genome Browser
Species Human (GRCh38)
Location 11:134412556-134412578
Sequence GGGTGGAATGGGGGTGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286857_1091286877 30 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286857_1091286872 13 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286857_1091286876 29 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286857_1091286863 -9 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286863 11:134412570-134412592 ATTCCACCCCGCCTCCATCCTGG No data
1091286857_1091286868 1 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286857 Original CRISPR GGGTGGAATGGGGGTGCAGG CGG (reversed) Intergenic
No off target data available for this crispr