ID: 1091286858

View in Genome Browser
Species Human (GRCh38)
Location 11:134412559-134412581
Sequence GCGGGGTGGAATGGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286858_1091286868 -2 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286858_1091286872 10 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286858_1091286876 26 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286858_1091286877 27 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286858 Original CRISPR GCGGGGTGGAATGGGGGTGC AGG (reversed) Intergenic