ID: 1091286859

View in Genome Browser
Species Human (GRCh38)
Location 11:134412565-134412587
Sequence ATGGAGGCGGGGTGGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286859_1091286876 20 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286859_1091286872 4 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286859_1091286877 21 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286859_1091286868 -8 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286859 Original CRISPR ATGGAGGCGGGGTGGAATGG GGG (reversed) Intergenic
No off target data available for this crispr