ID: 1091286862

View in Genome Browser
Species Human (GRCh38)
Location 11:134412568-134412590
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286862_1091286876 17 Left 1091286862 11:134412568-134412590 CCATTCCACCCCGCCTCCATCCT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286862_1091286872 1 Left 1091286862 11:134412568-134412590 CCATTCCACCCCGCCTCCATCCT No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286862_1091286877 18 Left 1091286862 11:134412568-134412590 CCATTCCACCCCGCCTCCATCCT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286862 Original CRISPR AGGATGGAGGCGGGGTGGAA TGG (reversed) Intergenic