ID: 1091286864 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:134412573-134412595 |
| Sequence | CAGCCAGGATGGAGGCGGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 5 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1091286864_1091286872 | -4 | Left | 1091286864 | 11:134412573-134412595 | CCACCCCGCCTCCATCCTGGCTG | No data | ||
| Right | 1091286872 | 11:134412592-134412614 | GCTGCTCCTGGCGCCCAGCTTGG | No data | ||||
| 1091286864_1091286880 | 30 | Left | 1091286864 | 11:134412573-134412595 | CCACCCCGCCTCCATCCTGGCTG | No data | ||
| Right | 1091286880 | 11:134412626-134412648 | AAAGGGTGATTGTTTCCGGCCGG | No data | ||||
| 1091286864_1091286879 | 26 | Left | 1091286864 | 11:134412573-134412595 | CCACCCCGCCTCCATCCTGGCTG | No data | ||
| Right | 1091286879 | 11:134412622-134412644 | TCTCAAAGGGTGATTGTTTCCGG | No data | ||||
| 1091286864_1091286876 | 12 | Left | 1091286864 | 11:134412573-134412595 | CCACCCCGCCTCCATCCTGGCTG | No data | ||
| Right | 1091286876 | 11:134412608-134412630 | AGCTTGGCAGCCTCTCTCAAAGG | No data | ||||
| 1091286864_1091286877 | 13 | Left | 1091286864 | 11:134412573-134412595 | CCACCCCGCCTCCATCCTGGCTG | No data | ||
| Right | 1091286877 | 11:134412609-134412631 | GCTTGGCAGCCTCTCTCAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1091286864 | Original CRISPR | CAGCCAGGATGGAGGCGGGG TGG (reversed) | Intergenic | ||