ID: 1091286865

View in Genome Browser
Species Human (GRCh38)
Location 11:134412576-134412598
Sequence GAGCAGCCAGGATGGAGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286865_1091286872 -7 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286865_1091286877 10 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286865_1091286879 23 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286865_1091286881 28 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286865_1091286876 9 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286865_1091286880 27 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286865 Original CRISPR GAGCAGCCAGGATGGAGGCG GGG (reversed) Intergenic
No off target data available for this crispr