ID: 1091286866

View in Genome Browser
Species Human (GRCh38)
Location 11:134412577-134412599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286866_1091286879 22 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286866_1091286877 9 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286866_1091286876 8 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286866_1091286881 27 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286866_1091286880 26 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286866_1091286872 -8 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286866 Original CRISPR GGAGCAGCCAGGATGGAGGC GGG (reversed) Intergenic