ID: 1091286867

View in Genome Browser
Species Human (GRCh38)
Location 11:134412578-134412600
Sequence AGGAGCAGCCAGGATGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286867_1091286881 26 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286867_1091286879 21 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286867_1091286872 -9 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286872 11:134412592-134412614 GCTGCTCCTGGCGCCCAGCTTGG No data
1091286867_1091286877 8 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286867_1091286876 7 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286867_1091286880 25 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286867 Original CRISPR AGGAGCAGCCAGGATGGAGG CGG (reversed) Intergenic