ID: 1091286868

View in Genome Browser
Species Human (GRCh38)
Location 11:134412580-134412602
Sequence GCCTCCATCCTGGCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286859_1091286868 -8 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286855_1091286868 3 Left 1091286855 11:134412554-134412576 CCCCGCCTGCACCCCCATTCCAC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286861_1091286868 -10 Left 1091286861 11:134412567-134412589 CCCATTCCACCCCGCCTCCATCC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286854_1091286868 4 Left 1091286854 11:134412553-134412575 CCCCCGCCTGCACCCCCATTCCA No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286858_1091286868 -2 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286860_1091286868 -9 Left 1091286860 11:134412566-134412588 CCCCATTCCACCCCGCCTCCATC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286856_1091286868 2 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data
1091286857_1091286868 1 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286868 11:134412580-134412602 GCCTCCATCCTGGCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286868 Original CRISPR GCCTCCATCCTGGCTGCTCC TGG Intergenic