ID: 1091286869

View in Genome Browser
Species Human (GRCh38)
Location 11:134412581-134412603
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286869_1091286876 4 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286869_1091286879 18 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286869_1091286877 5 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286869_1091286881 23 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286869_1091286880 22 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286869 Original CRISPR GCCAGGAGCAGCCAGGATGG AGG (reversed) Intergenic