ID: 1091286870

View in Genome Browser
Species Human (GRCh38)
Location 11:134412584-134412606
Sequence GGCGCCAGGAGCAGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286870_1091286882 30 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286882 11:134412637-134412659 GTTTCCGGCCGGGCTGCTGCAGG No data
1091286870_1091286876 1 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286870_1091286880 19 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286870_1091286879 15 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286870_1091286881 20 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286870_1091286877 2 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286870 Original CRISPR GGCGCCAGGAGCAGCCAGGA TGG (reversed) Intergenic