ID: 1091286871

View in Genome Browser
Species Human (GRCh38)
Location 11:134412588-134412610
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286871_1091286876 -3 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286871_1091286885 30 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286871_1091286877 -2 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286871_1091286882 26 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286882 11:134412637-134412659 GTTTCCGGCCGGGCTGCTGCAGG No data
1091286871_1091286881 16 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286871_1091286880 15 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286871_1091286883 29 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286883 11:134412640-134412662 TCCGGCCGGGCTGCTGCAGGAGG No data
1091286871_1091286879 11 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286871 Original CRISPR GCTGGGCGCCAGGAGCAGCC AGG (reversed) Intergenic