ID: 1091286874

View in Genome Browser
Species Human (GRCh38)
Location 11:134412605-134412627
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286874_1091286888 17 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286888 11:134412645-134412667 CCGGGCTGCTGCAGGAGGGCGGG No data
1091286874_1091286883 12 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286883 11:134412640-134412662 TCCGGCCGGGCTGCTGCAGGAGG No data
1091286874_1091286880 -2 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286874_1091286891 20 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286891 11:134412648-134412670 GGCTGCTGCAGGAGGGCGGGGGG No data
1091286874_1091286885 13 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286874_1091286881 -1 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286881 11:134412627-134412649 AAGGGTGATTGTTTCCGGCCGGG No data
1091286874_1091286886 16 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286886 11:134412644-134412666 GCCGGGCTGCTGCAGGAGGGCGG No data
1091286874_1091286889 18 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286889 11:134412646-134412668 CGGGCTGCTGCAGGAGGGCGGGG No data
1091286874_1091286879 -6 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286879 11:134412622-134412644 TCTCAAAGGGTGATTGTTTCCGG No data
1091286874_1091286892 23 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286892 11:134412651-134412673 TGCTGCAGGAGGGCGGGGGGCGG No data
1091286874_1091286882 9 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286882 11:134412637-134412659 GTTTCCGGCCGGGCTGCTGCAGG No data
1091286874_1091286890 19 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286890 11:134412647-134412669 GGGCTGCTGCAGGAGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286874 Original CRISPR TTGAGAGAGGCTGCCAAGCT GGG (reversed) Intergenic