ID: 1091286876

View in Genome Browser
Species Human (GRCh38)
Location 11:134412608-134412630
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286867_1091286876 7 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286865_1091286876 9 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286859_1091286876 20 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286871_1091286876 -3 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286860_1091286876 19 Left 1091286860 11:134412566-134412588 CCCCATTCCACCCCGCCTCCATC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286858_1091286876 26 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286866_1091286876 8 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286856_1091286876 30 Left 1091286856 11:134412555-134412577 CCCGCCTGCACCCCCATTCCACC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286864_1091286876 12 Left 1091286864 11:134412573-134412595 CCACCCCGCCTCCATCCTGGCTG No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286861_1091286876 18 Left 1091286861 11:134412567-134412589 CCCATTCCACCCCGCCTCCATCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286862_1091286876 17 Left 1091286862 11:134412568-134412590 CCATTCCACCCCGCCTCCATCCT No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286870_1091286876 1 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286869_1091286876 4 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data
1091286857_1091286876 29 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286876 11:134412608-134412630 AGCTTGGCAGCCTCTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286876 Original CRISPR AGCTTGGCAGCCTCTCTCAA AGG Intergenic