ID: 1091286877

View in Genome Browser
Species Human (GRCh38)
Location 11:134412609-134412631
Sequence GCTTGGCAGCCTCTCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286871_1091286877 -2 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286859_1091286877 21 Left 1091286859 11:134412565-134412587 CCCCCATTCCACCCCGCCTCCAT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286860_1091286877 20 Left 1091286860 11:134412566-134412588 CCCCATTCCACCCCGCCTCCATC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286867_1091286877 8 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286862_1091286877 18 Left 1091286862 11:134412568-134412590 CCATTCCACCCCGCCTCCATCCT No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286866_1091286877 9 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286857_1091286877 30 Left 1091286857 11:134412556-134412578 CCGCCTGCACCCCCATTCCACCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286864_1091286877 13 Left 1091286864 11:134412573-134412595 CCACCCCGCCTCCATCCTGGCTG No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286869_1091286877 5 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286861_1091286877 19 Left 1091286861 11:134412567-134412589 CCCATTCCACCCCGCCTCCATCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286858_1091286877 27 Left 1091286858 11:134412559-134412581 CCTGCACCCCCATTCCACCCCGC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286870_1091286877 2 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data
1091286865_1091286877 10 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286877 11:134412609-134412631 GCTTGGCAGCCTCTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286877 Original CRISPR GCTTGGCAGCCTCTCTCAAA GGG Intergenic