ID: 1091286878

View in Genome Browser
Species Human (GRCh38)
Location 11:134412618-134412640
Sequence AAACAATCACCCTTTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286878_1091286894 19 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286894 11:134412660-134412682 AGGGCGGGGGGCGGCGCTCTGGG No data
1091286878_1091286890 6 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286890 11:134412647-134412669 GGGCTGCTGCAGGAGGGCGGGGG No data
1091286878_1091286885 0 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286878_1091286889 5 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286889 11:134412646-134412668 CGGGCTGCTGCAGGAGGGCGGGG No data
1091286878_1091286883 -1 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286883 11:134412640-134412662 TCCGGCCGGGCTGCTGCAGGAGG No data
1091286878_1091286892 10 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286892 11:134412651-134412673 TGCTGCAGGAGGGCGGGGGGCGG No data
1091286878_1091286895 28 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286895 11:134412669-134412691 GGCGGCGCTCTGGGACCGAGAGG No data
1091286878_1091286891 7 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286891 11:134412648-134412670 GGCTGCTGCAGGAGGGCGGGGGG No data
1091286878_1091286882 -4 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286882 11:134412637-134412659 GTTTCCGGCCGGGCTGCTGCAGG No data
1091286878_1091286886 3 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286886 11:134412644-134412666 GCCGGGCTGCTGCAGGAGGGCGG No data
1091286878_1091286893 18 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286893 11:134412659-134412681 GAGGGCGGGGGGCGGCGCTCTGG No data
1091286878_1091286888 4 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286888 11:134412645-134412667 CCGGGCTGCTGCAGGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286878 Original CRISPR AAACAATCACCCTTTGAGAG AGG (reversed) Intergenic