ID: 1091286880

View in Genome Browser
Species Human (GRCh38)
Location 11:134412626-134412648
Sequence AAAGGGTGATTGTTTCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286873_1091286880 5 Left 1091286873 11:134412598-134412620 CCTGGCGCCCAGCTTGGCAGCCT No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286867_1091286880 25 Left 1091286867 11:134412578-134412600 CCGCCTCCATCCTGGCTGCTCCT No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286871_1091286880 15 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286866_1091286880 26 Left 1091286866 11:134412577-134412599 CCCGCCTCCATCCTGGCTGCTCC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286865_1091286880 27 Left 1091286865 11:134412576-134412598 CCCCGCCTCCATCCTGGCTGCTC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286864_1091286880 30 Left 1091286864 11:134412573-134412595 CCACCCCGCCTCCATCCTGGCTG No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286869_1091286880 22 Left 1091286869 11:134412581-134412603 CCTCCATCCTGGCTGCTCCTGGC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286874_1091286880 -2 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286875_1091286880 -3 Left 1091286875 11:134412606-134412628 CCAGCTTGGCAGCCTCTCTCAAA No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data
1091286870_1091286880 19 Left 1091286870 11:134412584-134412606 CCATCCTGGCTGCTCCTGGCGCC No data
Right 1091286880 11:134412626-134412648 AAAGGGTGATTGTTTCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286880 Original CRISPR AAAGGGTGATTGTTTCCGGC CGG Intergenic