ID: 1091286885

View in Genome Browser
Species Human (GRCh38)
Location 11:134412641-134412663
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286874_1091286885 13 Left 1091286874 11:134412605-134412627 CCCAGCTTGGCAGCCTCTCTCAA No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286875_1091286885 12 Left 1091286875 11:134412606-134412628 CCAGCTTGGCAGCCTCTCTCAAA No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286873_1091286885 20 Left 1091286873 11:134412598-134412620 CCTGGCGCCCAGCTTGGCAGCCT No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286871_1091286885 30 Left 1091286871 11:134412588-134412610 CCTGGCTGCTCCTGGCGCCCAGC No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data
1091286878_1091286885 0 Left 1091286878 11:134412618-134412640 CCTCTCTCAAAGGGTGATTGTTT No data
Right 1091286885 11:134412641-134412663 CCGGCCGGGCTGCTGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286885 Original CRISPR CCGGCCGGGCTGCTGCAGGA GGG Intergenic