ID: 1091286939

View in Genome Browser
Species Human (GRCh38)
Location 11:134412803-134412825
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286939_1091286946 14 Left 1091286939 11:134412803-134412825 CCCCGTGGAAGGGCACCTCGAGC No data
Right 1091286946 11:134412840-134412862 CTCACCCCAGCCTCCCCTTCCGG No data
1091286939_1091286947 15 Left 1091286939 11:134412803-134412825 CCCCGTGGAAGGGCACCTCGAGC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286939_1091286955 28 Left 1091286939 11:134412803-134412825 CCCCGTGGAAGGGCACCTCGAGC No data
Right 1091286955 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
1091286939_1091286950 19 Left 1091286939 11:134412803-134412825 CCCCGTGGAAGGGCACCTCGAGC No data
Right 1091286950 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286939 Original CRISPR GCTCGAGGTGCCCTTCCACG GGG (reversed) Intergenic