ID: 1091286942

View in Genome Browser
Species Human (GRCh38)
Location 11:134412818-134412840
Sequence GGCTGACGCGCGGCGGCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286942_1091286950 4 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286950 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data
1091286942_1091286955 13 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286955 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
1091286942_1091286960 28 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286942_1091286947 0 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286942_1091286958 21 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286942_1091286946 -1 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286946 11:134412840-134412862 CTCACCCCAGCCTCCCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286942 Original CRISPR GGCTGACGCGCGGCGGCTCG AGG (reversed) Intergenic
No off target data available for this crispr