ID: 1091286944

View in Genome Browser
Species Human (GRCh38)
Location 11:134412828-134412850
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286944_1091286965 27 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286944_1091286950 -6 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286950 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data
1091286944_1091286963 23 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data
1091286944_1091286947 -10 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286944_1091286955 3 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286955 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
1091286944_1091286964 24 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286944_1091286958 11 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286944_1091286960 18 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286944 Original CRISPR GCTGGGGTGAGGCTGACGCG CGG (reversed) Intergenic