ID: 1091286945

View in Genome Browser
Species Human (GRCh38)
Location 11:134412839-134412861
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286945_1091286965 16 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286945_1091286964 13 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286945_1091286967 25 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286945_1091286963 12 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data
1091286945_1091286958 0 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286945_1091286955 -8 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286955 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
1091286945_1091286969 29 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286945_1091286960 7 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286945_1091286968 26 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286945 Original CRISPR CGGAAGGGGAGGCTGGGGTG AGG (reversed) Intergenic