ID: 1091286947

View in Genome Browser
Species Human (GRCh38)
Location 11:134412841-134412863
Sequence TCACCCCAGCCTCCCCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286943_1091286947 -7 Left 1091286943 11:134412825-134412847 CCGCCGCGCGTCAGCCTCACCCC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286939_1091286947 15 Left 1091286939 11:134412803-134412825 CCCCGTGGAAGGGCACCTCGAGC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286942_1091286947 0 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286941_1091286947 13 Left 1091286941 11:134412805-134412827 CCGTGGAAGGGCACCTCGAGCCG No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286940_1091286947 14 Left 1091286940 11:134412804-134412826 CCCGTGGAAGGGCACCTCGAGCC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data
1091286944_1091286947 -10 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286947 11:134412841-134412863 TCACCCCAGCCTCCCCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286947 Original CRISPR TCACCCCAGCCTCCCCTTCC GGG Intergenic