ID: 1091286948

View in Genome Browser
Species Human (GRCh38)
Location 11:134412844-134412866
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286948_1091286964 8 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286948_1091286968 21 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286948_1091286958 -5 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286948_1091286960 2 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286948_1091286969 24 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286948_1091286972 28 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286948_1091286965 11 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286948_1091286973 29 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286948_1091286967 20 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286948_1091286963 7 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286948 Original CRISPR CGGCCCGGAAGGGGAGGCTG GGG (reversed) Intergenic