ID: 1091286951

View in Genome Browser
Species Human (GRCh38)
Location 11:134412846-134412868
Sequence ACCGGCCCGGAAGGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286951_1091286972 26 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286951_1091286967 18 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286951_1091286964 6 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286951_1091286968 19 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286951_1091286963 5 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data
1091286951_1091286958 -7 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286951_1091286969 22 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286951_1091286960 0 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286951_1091286973 27 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286951_1091286965 9 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286951 Original CRISPR ACCGGCCCGGAAGGGGAGGC TGG (reversed) Intergenic