ID: 1091286952

View in Genome Browser
Species Human (GRCh38)
Location 11:134412850-134412872
Sequence GTGCACCGGCCCGGAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286952_1091286960 -4 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286952_1091286967 14 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286952_1091286976 29 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286952_1091286972 22 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286952_1091286973 23 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286952_1091286975 28 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286975 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
1091286952_1091286964 2 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286952_1091286963 1 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data
1091286952_1091286969 18 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286952_1091286965 5 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286952_1091286968 15 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286952_1091286977 30 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286977 11:134412903-134412925 TGCGTGGGCGGACGGGCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286952 Original CRISPR GTGCACCGGCCCGGAAGGGG AGG (reversed) Intergenic
No off target data available for this crispr