ID: 1091286954

View in Genome Browser
Species Human (GRCh38)
Location 11:134412854-134412876
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286954_1091286973 19 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286954_1091286977 26 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286977 11:134412903-134412925 TGCGTGGGCGGACGGGCGCGGGG No data
1091286954_1091286965 1 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286954_1091286967 10 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286954_1091286963 -3 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data
1091286954_1091286978 29 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG No data
1091286954_1091286976 25 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286954_1091286972 18 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286954_1091286975 24 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286975 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
1091286954_1091286969 14 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286954_1091286960 -8 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG No data
1091286954_1091286968 11 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286954_1091286964 -2 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286954 Original CRISPR CCGGGTGCACCGGCCCGGAA GGG (reversed) Intergenic