ID: 1091286957

View in Genome Browser
Species Human (GRCh38)
Location 11:134412859-134412881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286957_1091286973 14 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286957_1091286976 20 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286957_1091286969 9 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286957_1091286968 6 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286957_1091286978 24 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG No data
1091286957_1091286977 21 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286977 11:134412903-134412925 TGCGTGGGCGGACGGGCGCGGGG No data
1091286957_1091286965 -4 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286957_1091286980 29 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286980 11:134412911-134412933 CGGACGGGCGCGGGGAGGCCGGG No data
1091286957_1091286972 13 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286957_1091286975 19 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286975 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
1091286957_1091286964 -7 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286957_1091286979 28 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286979 11:134412910-134412932 GCGGACGGGCGCGGGGAGGCCGG No data
1091286957_1091286967 5 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286957_1091286981 30 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286957_1091286963 -8 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286963 11:134412874-134412896 CGGCGTTCCGGAGAGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286957 Original CRISPR GAACGCCGGGTGCACCGGCC CGG (reversed) Intergenic