ID: 1091286958

View in Genome Browser
Species Human (GRCh38)
Location 11:134412862-134412884
Sequence GGCCGGTGCACCCGGCGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286945_1091286958 0 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286948_1091286958 -5 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286943_1091286958 14 Left 1091286943 11:134412825-134412847 CCGCCGCGCGTCAGCCTCACCCC No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286942_1091286958 21 Left 1091286942 11:134412818-134412840 CCTCGAGCCGCCGCGCGTCAGCC No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286944_1091286958 11 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286949_1091286958 -6 Left 1091286949 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data
1091286951_1091286958 -7 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286958 11:134412862-134412884 GGCCGGTGCACCCGGCGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286958 Original CRISPR GGCCGGTGCACCCGGCGTTC CGG Intergenic