ID: 1091286959

View in Genome Browser
Species Human (GRCh38)
Location 11:134412864-134412886
Sequence CTCCGGAACGCCGGGTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286959_1091286976 15 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286959_1091286972 8 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286959_1091286969 4 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286959_1091286978 19 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG No data
1091286959_1091286968 1 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286968 11:134412888-134412910 GAGGCCCGGGAGGCCTGCGTGGG No data
1091286959_1091286982 26 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286982 11:134412913-134412935 GACGGGCGCGGGGAGGCCGGGGG No data
1091286959_1091286967 0 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286967 11:134412887-134412909 AGAGGCCCGGGAGGCCTGCGTGG No data
1091286959_1091286980 24 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286980 11:134412911-134412933 CGGACGGGCGCGGGGAGGCCGGG No data
1091286959_1091286981 25 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286959_1091286979 23 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286979 11:134412910-134412932 GCGGACGGGCGCGGGGAGGCCGG No data
1091286959_1091286975 14 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286975 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
1091286959_1091286977 16 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286977 11:134412903-134412925 TGCGTGGGCGGACGGGCGCGGGG No data
1091286959_1091286965 -9 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286965 11:134412878-134412900 GTTCCGGAGAGAGGCCCGGGAGG No data
1091286959_1091286973 9 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286959 Original CRISPR CTCCGGAACGCCGGGTGCAC CGG (reversed) Intergenic