ID: 1091286964

View in Genome Browser
Species Human (GRCh38)
Location 11:134412875-134412897
Sequence GGCGTTCCGGAGAGAGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286943_1091286964 27 Left 1091286943 11:134412825-134412847 CCGCCGCGCGTCAGCCTCACCCC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286948_1091286964 8 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286953_1091286964 -1 Left 1091286953 11:134412853-134412875 CCCCTTCCGGGCCGGTGCACCCG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286951_1091286964 6 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286944_1091286964 24 Left 1091286944 11:134412828-134412850 CCGCGCGTCAGCCTCACCCCAGC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286954_1091286964 -2 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286945_1091286964 13 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286956_1091286964 -3 Left 1091286956 11:134412855-134412877 CCTTCCGGGCCGGTGCACCCGGC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286957_1091286964 -7 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286949_1091286964 7 Left 1091286949 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data
1091286952_1091286964 2 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286964 11:134412875-134412897 GGCGTTCCGGAGAGAGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286964 Original CRISPR GGCGTTCCGGAGAGAGGCCC GGG Intergenic
No off target data available for this crispr