ID: 1091286966

View in Genome Browser
Species Human (GRCh38)
Location 11:134412881-134412903
Sequence AGGCCTCCCGGGCCTCTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286966_1091286986 25 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data
1091286966_1091286977 -1 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286977 11:134412903-134412925 TGCGTGGGCGGACGGGCGCGGGG No data
1091286966_1091286983 15 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286966_1091286978 2 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG No data
1091286966_1091286984 16 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286984 11:134412920-134412942 GCGGGGAGGCCGGGGGCAGCGGG No data
1091286966_1091286972 -9 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286972 11:134412895-134412917 GGGAGGCCTGCGTGGGCGGACGG No data
1091286966_1091286976 -2 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286966_1091286975 -3 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286975 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
1091286966_1091286982 9 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286982 11:134412913-134412935 GACGGGCGCGGGGAGGCCGGGGG No data
1091286966_1091286973 -8 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286973 11:134412896-134412918 GGAGGCCTGCGTGGGCGGACGGG No data
1091286966_1091286979 6 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286979 11:134412910-134412932 GCGGACGGGCGCGGGGAGGCCGG No data
1091286966_1091286981 8 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286966_1091286980 7 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286980 11:134412911-134412933 CGGACGGGCGCGGGGAGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286966 Original CRISPR AGGCCTCCCGGGCCTCTCTC CGG (reversed) Intergenic