ID: 1091286969

View in Genome Browser
Species Human (GRCh38)
Location 11:134412891-134412913
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286949_1091286969 23 Left 1091286949 11:134412845-134412867 CCCAGCCTCCCCTTCCGGGCCGG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286962_1091286969 -5 Left 1091286962 11:134412873-134412895 CCGGCGTTCCGGAGAGAGGCCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286953_1091286969 15 Left 1091286953 11:134412853-134412875 CCCCTTCCGGGCCGGTGCACCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286951_1091286969 22 Left 1091286951 11:134412846-134412868 CCAGCCTCCCCTTCCGGGCCGGT No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286959_1091286969 4 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286945_1091286969 29 Left 1091286945 11:134412839-134412861 CCTCACCCCAGCCTCCCCTTCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286952_1091286969 18 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286956_1091286969 13 Left 1091286956 11:134412855-134412877 CCTTCCGGGCCGGTGCACCCGGC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286961_1091286969 -4 Left 1091286961 11:134412872-134412894 CCCGGCGTTCCGGAGAGAGGCCC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286954_1091286969 14 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286957_1091286969 9 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data
1091286948_1091286969 24 Left 1091286948 11:134412844-134412866 CCCCAGCCTCCCCTTCCGGGCCG No data
Right 1091286969 11:134412891-134412913 GCCCGGGAGGCCTGCGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286969 Original CRISPR GCCCGGGAGGCCTGCGTGGG CGG Intergenic
No off target data available for this crispr