ID: 1091286971

View in Genome Browser
Species Human (GRCh38)
Location 11:134412893-134412915
Sequence GTCCGCCCACGCAGGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286971_1091286978 -10 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286978 11:134412906-134412928 GTGGGCGGACGGGCGCGGGGAGG No data
1091286971_1091286979 -6 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286979 11:134412910-134412932 GCGGACGGGCGCGGGGAGGCCGG No data
1091286971_1091286982 -3 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286982 11:134412913-134412935 GACGGGCGCGGGGAGGCCGGGGG No data
1091286971_1091286986 13 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data
1091286971_1091286980 -5 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286980 11:134412911-134412933 CGGACGGGCGCGGGGAGGCCGGG No data
1091286971_1091286987 23 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286987 11:134412939-134412961 CGGGATCTCCAGGAGTTTCCCGG No data
1091286971_1091286988 24 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286988 11:134412940-134412962 GGGATCTCCAGGAGTTTCCCGGG No data
1091286971_1091286983 3 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286971_1091286981 -4 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286971_1091286984 4 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286984 11:134412920-134412942 GCGGGGAGGCCGGGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286971 Original CRISPR GTCCGCCCACGCAGGCCTCC CGG (reversed) Intergenic