ID: 1091286976

View in Genome Browser
Species Human (GRCh38)
Location 11:134412902-134412924
Sequence CTGCGTGGGCGGACGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286962_1091286976 6 Left 1091286962 11:134412873-134412895 CCGGCGTTCCGGAGAGAGGCCCG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286957_1091286976 20 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286953_1091286976 26 Left 1091286953 11:134412853-134412875 CCCCTTCCGGGCCGGTGCACCCG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286961_1091286976 7 Left 1091286961 11:134412872-134412894 CCCGGCGTTCCGGAGAGAGGCCC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286966_1091286976 -2 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286954_1091286976 25 Left 1091286954 11:134412854-134412876 CCCTTCCGGGCCGGTGCACCCGG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286952_1091286976 29 Left 1091286952 11:134412850-134412872 CCTCCCCTTCCGGGCCGGTGCAC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286956_1091286976 24 Left 1091286956 11:134412855-134412877 CCTTCCGGGCCGGTGCACCCGGC No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data
1091286959_1091286976 15 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286976 11:134412902-134412924 CTGCGTGGGCGGACGGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286976 Original CRISPR CTGCGTGGGCGGACGGGCGC GGG Intergenic