ID: 1091286981

View in Genome Browser
Species Human (GRCh38)
Location 11:134412912-134412934
Sequence GGACGGGCGCGGGGAGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286962_1091286981 16 Left 1091286962 11:134412873-134412895 CCGGCGTTCCGGAGAGAGGCCCG No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286957_1091286981 30 Left 1091286957 11:134412859-134412881 CCGGGCCGGTGCACCCGGCGTTC No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286959_1091286981 25 Left 1091286959 11:134412864-134412886 CCGGTGCACCCGGCGTTCCGGAG No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286961_1091286981 17 Left 1091286961 11:134412872-134412894 CCCGGCGTTCCGGAGAGAGGCCC No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286970_1091286981 -3 Left 1091286970 11:134412892-134412914 CCCGGGAGGCCTGCGTGGGCGGA No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286966_1091286981 8 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data
1091286971_1091286981 -4 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286981 11:134412912-134412934 GGACGGGCGCGGGGAGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286981 Original CRISPR GGACGGGCGCGGGGAGGCCG GGG Intergenic