ID: 1091286983

View in Genome Browser
Species Human (GRCh38)
Location 11:134412919-134412941
Sequence CGCGGGGAGGCCGGGGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1437
Summary {0: 1, 1: 0, 2: 6, 3: 124, 4: 1306}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286966_1091286983 15 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286974_1091286983 -5 Left 1091286974 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286961_1091286983 24 Left 1091286961 11:134412872-134412894 CCCGGCGTTCCGGAGAGAGGCCC No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286971_1091286983 3 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286970_1091286983 4 Left 1091286970 11:134412892-134412914 CCCGGGAGGCCTGCGTGGGCGGA No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306
1091286962_1091286983 23 Left 1091286962 11:134412873-134412895 CCGGCGTTCCGGAGAGAGGCCCG No data
Right 1091286983 11:134412919-134412941 CGCGGGGAGGCCGGGGGCAGCGG 0: 1
1: 0
2: 6
3: 124
4: 1306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286983 Original CRISPR CGCGGGGAGGCCGGGGGCAG CGG Intergenic