ID: 1091286986

View in Genome Browser
Species Human (GRCh38)
Location 11:134412929-134412951
Sequence CCGGGGGCAGCGGGATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091286971_1091286986 13 Left 1091286971 11:134412893-134412915 CCGGGAGGCCTGCGTGGGCGGAC No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data
1091286974_1091286986 5 Left 1091286974 11:134412901-134412923 CCTGCGTGGGCGGACGGGCGCGG No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data
1091286970_1091286986 14 Left 1091286970 11:134412892-134412914 CCCGGGAGGCCTGCGTGGGCGGA No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data
1091286966_1091286986 25 Left 1091286966 11:134412881-134412903 CCGGAGAGAGGCCCGGGAGGCCT No data
Right 1091286986 11:134412929-134412951 CCGGGGGCAGCGGGATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091286986 Original CRISPR CCGGGGGCAGCGGGATCTCC AGG Intergenic