ID: 1091293439

View in Genome Browser
Species Human (GRCh38)
Location 11:134455443-134455465
Sequence CAGCAAGGCCCTACTCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293439_1091293444 4 Left 1091293439 11:134455443-134455465 CCATCTTGAGTAGGGCCTTGCTG No data
Right 1091293444 11:134455470-134455492 CTGCTGGGCTGCACTCCCATAGG No data
1091293439_1091293448 25 Left 1091293439 11:134455443-134455465 CCATCTTGAGTAGGGCCTTGCTG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447
1091293439_1091293445 9 Left 1091293439 11:134455443-134455465 CCATCTTGAGTAGGGCCTTGCTG No data
Right 1091293445 11:134455475-134455497 GGGCTGCACTCCCATAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293439 Original CRISPR CAGCAAGGCCCTACTCAAGA TGG (reversed) Intergenic
No off target data available for this crispr