ID: 1091293442

View in Genome Browser
Species Human (GRCh38)
Location 11:134455458-134455480
Sequence CAGCCCAGCAGGTCTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293442_1091293449 20 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314
1091293442_1091293448 10 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447
1091293442_1091293450 23 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435
1091293442_1091293445 -6 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293445 11:134455475-134455497 GGGCTGCACTCCCATAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293442 Original CRISPR CAGCCCAGCAGGTCTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr