ID: 1091293443

View in Genome Browser
Species Human (GRCh38)
Location 11:134455469-134455491
Sequence CTATGGGAGTGCAGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293443_1091293449 9 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293449 11:134455501-134455523 TCTAAGTCACAGGATGAGATAGG 0: 488
1: 780
2: 613
3: 352
4: 314
1091293443_1091293451 29 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293451 11:134455521-134455543 AGGAGGTCAGCACAAGTTACAGG No data
1091293443_1091293448 -1 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447
1091293443_1091293450 12 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293450 11:134455504-134455526 AAGTCACAGGATGAGATAGGAGG 0: 408
1: 684
2: 640
3: 404
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293443 Original CRISPR CTATGGGAGTGCAGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr