HTGT WGE

Individual CRISPR Summary

ID: 1091293448

 View in Genome Browser
Species Human (GRCh38)
Location 11:134455491-134455513
Sequence GGTTAGGCATTCTAAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2437
Summary {0: 149, 1: 387, 2: 774, 3: 680, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091293442_1091293448 10 Left 1091293442 11:134455458-134455480 CCTTGCTGAGACCTGCTGGGCTG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447
1091293439_1091293448 25 Left 1091293439 11:134455443-134455465 CCATCTTGAGTAGGGCCTTGCTG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447
1091293443_1091293448 -1 Left 1091293443 11:134455469-134455491 CCTGCTGGGCTGCACTCCCATAG No data
Right 1091293448 11:134455491-134455513 GGTTAGGCATTCTAAGTCACAGG 0: 149
1: 387
2: 774
3: 680
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091293448 Original CRISPR GGTTAGGCATTCTAAGTCAC AGG Intergenic
Too many off-targets to display for this crispr